EMAGINATORIUM GUESTBOOK MESSAGES
We hope you enjoy what students and adult shave to say. Here
is a place where students and adults can respond to school technology activities
and contests. Each entry shows the time and date so we can tell when a
message was posted. It usually takes 24 hours before your message
will be posted here.
Would you like to Add another message?
Urlaubt Hallöchen,durch zufall bin ich auf diese
Seite geraten,und ich finde sie sehr interessant und ansprechend. Macht
weiter so,ich schau auf jedenfall nochmal vorbei.lieben grus
Urlaub
de, - Thursday, December 02, 2004 at 03:30:43 (EST)
Good morning, I am new to this site. I have just learned about this
from my supervisor, Gayle Broad Algoma University. I am going to read on
and it's very interesting to know
Kredit ohne schufa
de, - Monday, November 29, 2004 at 04:40:54 (EST)
Sofortkredit Diese seite ist genauso interessant wie informativ.
Viele Grüße!
Kreditvermittlung
de, - Thursday, November 25, 2004 at 06:53:07 (EST)
My brother and I are on your website right now.
Gabriella R. 401
N.Y, USA - Sunday, November 21, 2004 at 12:42:10 (EST)
I am having fun on your website
Gabriella R. 401
N.Y, USA - Sunday, November 21, 2004 at 12:40:21 (EST)
i love you melissa,.bennett,.emma,.savannh,.louis.
erin,5, k012
Forest Hills, NY USA - Sunday, November 21, 2004 at 10:44:30 (EST)
hello computer man
erin, 5, k012
forest hills, ny USA - Sunday, November 21, 2004 at 10:30:40 (EST)
I made a word serch puzzle.
Jiyung 5 102 PS101
Forest Hills, N.Y. USA - Sunday, November 21, 2004 at 08:39:38 (EST)
my grandpa likes the coler yellow
isabella 6
USA - Saturday, November 20, 2004 at 18:42:37 (EST)
Mr. Stein; I like your class. I will see you on Thursday. TAKE CARE,
ELENA
elena s k-031 ps101
kew gardens, ny USA - Saturday, November 20, 2004 at 09:30:36 (EST)
Hiya mr. stein! My mother loves your website. She says it's the
bomb!(Well she said it is good not the bomb.) =) My birthday was on monday.
It was just a day before computers(sigh)=(
Shirley 11 602 P.S.101
Forest Hills, NY USA - Friday, November 19, 2004 at 20:59:42 (EST)
alison got the hershy bar.
sabrina,8,303
USA - Thursday, November 18, 2004 at 16:15:12 (EST)
hello computerman can you bring me a puppy
andy 6 103
USA - Thursday, November 18, 2004 at 13:00:36 (EST)
privatkredit Sehr informative Seite. Vielen Dank für die Infos!
kredite
de, - Thursday, November 18, 2004 at 06:53:56 (EST)
Mr.Stein, here is an example of a cynquom and instructions. line
1.dog line 2.Loyal,Trustworthy line 3.Bark,Run,Eat line 4.Friendly,Funny,Furry,Joyful
line 5.Doggie By:Adam S INSTRUCTIONS line 1. Your subject. line 2. Descriptive
words about subject. line 3. What your subject does. line 4. Feeling words
about your subject line 5. A synynim of your subject. Your name. That is
how you make a cynquom.
Adam S. 10 501
N.Y.C, NY USA - Wednesday, November 17, 2004 at 15:31:26 (EST)
Hi! msr.computerman.I was wondering how you look like and if i could
talk with you.you talk like this right Hi my name is mrs computerman.LOL
(laugh out loud).OK THATS ALL I HAVE TTTTTTTTTTTTTTOOOOOOOOOOOOOOOOOOOOOOO
SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Granit L Age 8
forest hills, NY USA - Tuesday, November 16, 2004 at 19:35:41 (EST)
günstige kredite Eine Wahnsinns - Website. Bei all meinen Surf-touren
ist mir noch nicht so eine informative Site begegnet. Dies zeigt mir das
das Internet nicht nur aus Blabla und Sc
haarausfall
de, - Tuesday, November 16, 2004 at 15:02:51 (EST)
Hi Mr.Stein I made one of those maps.I'l show it to you the next
time i'm in your class. Bye for now.
Melissa 11 602
New York, NY USA - Tuesday, November 16, 2004 at 13:16:28 (EST)
busen wow , just found this site again . Back in Germany ,Düsseldorf
are still going strong I hope to be in Holland with them in February .
Check them out on 13th Feb.
Titten
de, - Tuesday, November 16, 2004 at 03:13:08 (EST)
Dear Mr.Stiny I am so happy that I did it. I did it' and it was
so fun. I hade a great time
Jacklyn 7 302
USA - Monday, November 15, 2004 at 13:13:09 (EST)
Mr.Stein!Mr.Stein!Mr.Stein!!!!!!!!!!!!I just made a map.It has nothing
between.I wanted to go to Kew Garden-Union Turnpike.It was only one stop.Yeah!I
am so smart!
Colleen 8 302
USA - Monday, November 15, 2004 at 13:12:39 (EST)
what.what.blablabla.uh.
kathy 6 103
USA - Sunday, November 14, 2004 at 18:28:16 (EST)
lalalalawawawa.lalalawawawa.
kathy 6 103
USA - Sunday, November 14, 2004 at 18:25:49 (EST)
I lost a tooth! Mr.Stein I printed a tooth fairy envlope too.
kathy 6 103
USA - Sunday, November 14, 2004 at 18:16:47 (EST)
Hi Mr.Stein. I know the answer to the Crystal Ball. They are:81,72,54,45,36,27,18
and 9. Merry Christmas Mr.stein!!!!!!
Karolina 10 Kew Forest School
Forest Hills, N.Y. USA - Sunday, November 14, 2004 at 16:05:30 (EST)
I love you.
chibueze 7 203
USA - Saturday, November 13, 2004 at 12:33:48 (EST)
I love you.
chibueze 7 203
USA - Saturday, November 13, 2004 at 12:33:48 (EST)
Dear Mr.Stein,I am in Germantown, NY.I just want you to know that
it is snowing .I went sledding yesterday.I had fun. My dad just made a
fire in the woodstove. It is 33 degrees at 9.17. My cat Henry is purring
his head off.It is cold outside.Member of the cool club,Adela.
Adela 7 203
USA - Saturday, November 13, 2004 at 09:38:21 (EST)
???.???.
Jean,10,5-214,P.S.205
Fresh Meadows, NY USA - Friday, November 12, 2004 at 16:06:37 (EST)
My sister is writing this for me, so don't be confused if this is
better typed than a K would do it. The answer for the money machine contest
is that all the coins are different sizes and the coin keeps on slidind
untill the coin finds it's own size, aren't I smart:-) P.S- My brother
has seen the money machine before in a store and we put in a penney to
test it out.
Bennett 5 K013 ps101Q
New York, NY USA - Thursday, November 11, 2004 at 14:02:47 (EST)
My sister is writing this for me, so don't be confused if this is
better typed than a K would do it. The answer for the money machine contest
is that all the coins are different sizes and the coin keeps on slidind
untill the coin finds it's own size, aren't I smart:-) P.S- My brother
has seen the money machine before in a stoe and we put in a penney to test
it out.
Bennett 5 K013
New York, NY USA - Thursday, November 11, 2004 at 14:02:06 (EST)
Dear Mr. Stein, Can you show me how to make my own website?
Jessica,,8,302
NYC, NY USA - Thursday, November 11, 2004 at 12:58:46 (EST)
Did you know that I made a paper turkey in my room? I printed a
GREAT tooth fariy envalope!
kathy 6
USA - Thursday, November 11, 2004 at 11:35:46 (EST)
Did you know that I made a paper turkey in my room? I printed a
GREAT tooth fariy envalope!
kathy 6 103
USA - Thursday, November 11, 2004 at 11:35:45 (EST)
Dear Mr. Gelber, I can repeat the poem. It is 30 days has September,
April, June, and November. All the rest have 31 exept Febuary which has
28 days. 29 days in a leap year. Frank
Frank 7 203
USA - Thursday, November 11, 2004 at 09:08:24 (EST)
ratenkredit Servus ihr da alle ich grüße euch recht herzlich
und ganz besonder die Katha (ich bin mal da drauf gegangen um zu schauen
was hier alles so steht) meine Schneckenfreundin fe
Sofortkredit
de, - Thursday, November 11, 2004 at 07:03:39 (EST)
MESSAGE TO: jiyung 5 102 ps101 Thank you for your message. PI am
proud of you. You are 5 years old and very smart!!!!!! From Mr. Stein
Mr. Stein
USA - Wednesday, November 10, 2004 at 22:16:43 (EST)
I am in Mrs.Susan's class
Jack C 4 -011
USA - Wednesday, November 10, 2004 at 22:10:16 (EST)
DearMr.Stein I just had a new compueter on the last 2 week.Now I
have my own compueter.So I could write the message to evryone I want.BOO
WHO BOO BOO BOO.
Natthinee 9 303
New York, U.S. USA - Wednesday, November 10, 2004 at 21:00:14 (EST)
Dear Mr.Gelber ,I can repeat the poem.It is.Thirty days has september,april,june
and november.All the rest have thirty one except for february wich has
twenty eight.There are twenty nine days in a leapyear.
Roxanne 7 , 2-203 p.s.101
Forest Hills, NY USA - Wednesday, November 10, 2004 at 18:40:11 (EST)
hi mr.stien.i hope my messege is sent to you.you could send a letter
to me.bye!
jiyung 5 102
forest hills, NY USA - Tuesday, November 09, 2004 at 17:36:36 (EST)
Ich finde Ihre Homepage sehr gut und fundiert. Die Informationen
helfen mir bei Vaterschaftstest für den Aufbau einer Dokumentation
vielen Dank und weiter so. Dietmar
Klingeltöne
de, - Tuesday, November 09, 2004 at 07:18:41 (EST)
i put mr stien together.
jiyung 5 102 ps101
forest hills, new york USA - Monday, November 08, 2004 at 19:42:22
(EST)
i put mr.stien together.
jiyung 5 102
forest hills, new york USA - Monday, November 08, 2004 at 19:38:32
(EST)
afggnjgkj
102
USA - Monday, November 08, 2004 at 16:35:35 (EST)
Brautfrisuren I enjoyed this site very much and have taken away
a better insight. I will recommend this site to everyone I know. More people
should step into.
Rechtsanwalt
de, - Monday, November 08, 2004 at 15:15:42 (EST)
Why weren't at computer last week? you were sick? hello??????
Kathy 6 103
USA - Sunday, November 07, 2004 at 18:29:33 (EST)
hi mr. stein!
julia b., 5, k013,
Forest Hills, NY USA - Sunday, November 07, 2004 at 09:12:28 (EST)
pshgfjdioe0irjfjofp[pr[ff-r=-pfr-0fokldfpp[[d[-fro0gitunhjynhfiiys8yeygf7rg6rgr866583930-2-1-1-1-103948gnhnhgjgj
anthony5104
USA - Sunday, November 07, 2004 at 08:21:51 (EST)
Very good webpage you have here and best greetings to all your visitors.
Kredit
Kredite
de, - Sunday, November 07, 2004 at 06:05:56 (EST)
I AM RAVEN
XENA, 6
USA - Saturday, November 06, 2004 at 12:54:36 (EST)
Hi it's me Chloe.I miss you guys alot. I am fine in my new school.I
love my new school.It is really fun.
chloe M. 8 john philip sousa
port washington, NY USA - Saturday, November 06, 2004 at 09:28:46 (EST)
wasserbetten Excelente Idee alle diese Informationen zu presentieren.
Wasserbetten
de, - Saturday, November 06, 2004 at 07:54:02 (EST)
i;oveyoumom
pierre6
USA - Friday, November 05, 2004 at 17:36:31 (EST)
Cool site, I'd say hi and best wishes to You, for more gedichte
Gedicht
de, - Friday, November 05, 2004 at 15:20:56 (EST)
Dear Mr. Gelber, I can repeat the poem. It is "30 days has September,
April, June and November. All the rest has 31 except February wich has
28 and 29 days in a leap year."
Ayane, T. 6, 2-203,
USA - Thursday, November 04, 2004 at 21:29:37 (EST)
I LIKE MIS COMPUTER AND MAN
7 LALA 202
USA - Thursday, November 04, 2004 at 21:01:53 (EST)
Dear Mr. Gelber, I can repeat the poem. It is 30 days has September,
April, June and November. All of rest 31days except Feburary which has
28days and 29days in Olympia.
Mai Kamio, 7, 2-203,
Forest Hills, NY USA - Thursday, November 04, 2004 at 20:32:46 (EST)
I went to see you recite the month of the year.It is Thirty day's
have September,April,June and November.All the rest have 31 except February
wich has 28 and 29 day's in a leap year.
ALI 7. 203 P.S.101
NYC, NY USA - Thursday, November 04, 2004 at 20:15:40 (EST)
I went to see you recite the month of the year.It is Thirty day's
have September,April,June and November.All the rest have 31 except February
which has 28 and 29 day's in a leap year.
Yoni 7 203 P.S.101
N.Y., N.Y. USA - Thursday, November 04, 2004 at 19:03:28 (EST)
Dear Mr. Gelber, I can repeat the poem. It is: Thirty days has September,
April, June and November all the rest have 31, except February which has
28 or 29 in a leap year
Roee Farjoun, 7,2-203, PS 101
New York, NY USA - Thursday, November 04, 2004 at 16:51:23 (EST)
taylor love m stein
taylor.5.k-o31
USA - Thursday, November 04, 2004 at 10:02:05 (EST)
Schufafreie Kredite Diese seite ist genauso interessant wie informativ.
Viele Grüße!
Girokonto
de, - Thursday, November 04, 2004 at 07:34:03 (EST)
Dear Mr.Gelber, I can memorize the month poem. It is,"30 days has
September, April, June, and November. All the rest has 31 exept February
which has 28 and 29 on leap year." Love, Justin
Justin 7 2-203 P.S.101
USA - Wednesday, November 03, 2004 at 19:47:03 (EST)
Dear Mr.Gelber, I can memorize the month poem. It is,"30 days has
September, April, June, and November. All the rest has 31 exept February
which has 28 and 29 on ieap year." Love, Justin
Justin 7 2-203 P.S.101
USA - Wednesday, November 03, 2004 at 19:46:28 (EST)
Mr.Stein, I want to open a website about endangered animals.
Adam s. 10 501 p.s.101
nyc, ny USA - Wednesday, November 03, 2004 at 14:27:38 (EST)
I see nia. I like her pink sweater with a white star.
Nia 6 104
USA - Wednesday, November 03, 2004 at 10:59:24 (EST)
30 days has September, April, June and November. All the rest have
31 except February that has 28 and 29 days in the leap year.
Daniel 7 203 p.s.101
USA - Tuesday, November 02, 2004 at 20:16:53 (EST)
I am in 4 grade with Mr Frank, i do like the webside that Mr Stein
put up , I am happy to write to you.
Alexandra b, 9 years old, ps101 Queens
FH. NEW YORK, NY USA - Tuesday, November 02, 2004 at 20:05:14 (EST)
Mr.Gelber I like your poem very much.I could write it down."30 days
has September,April,June and November.All the rest have 31 exept Janarary
that has 28 and 29 days in the leap year."
Daniel 7 203 p.s.101
USA - Tuesday, November 02, 2004 at 19:52:44 (EST)
I like you Mr.Stine.
Toma 6 101 ps101
F.H., .N.Y. USA - Tuesday, November 02, 2004 at 07:53:16 (EST)
Mr.Stine are you tired?
Toma 6 ps101 101
USA - Tuesday, November 02, 2004 at 07:47:01 (EST)
Hi Mr.Stein.How are you doing?
Jaelahbantum 7
USA - Monday, November 01, 2004 at 20:16:05 (EST)
I had a SUPER halloween! Mr. Stein I got 58 candys!!!!!
Kathy 6 103
USA - Sunday, October 31, 2004 at 19:56:56 (EST)
Hi Mr. Stein...I'm on your website with my little brother. Hes having
alot of fun looking at all of your links. Thanks for making such a great
website!
Sarah, 13 and John,4
Forest Hills, Ny USA - Sunday, October 31, 2004 at 11:41:00 (EST)
dfwffgwwvsgwfeqwyft2fwqfw
diego5k013
USA - Sunday, October 31, 2004 at 10:06:13 (EST)
hi my name is taylor and my brothbr matthew we like to go to the
beach.
taylor k-031
nyc, nys USA - Saturday, October 30, 2004 at 21:38:01 (EDT)
How is everybody? I learnd to ice skate. i was in mrs Singh's class
last year.
Noah K., 6, 1st grade, Coman hill Elem. School
Armonk, NY USA - Saturday, October 30, 2004 at 16:33:48 (EDT)
I put you together.
Evalena 6
USA - Saturday, October 30, 2004 at 12:45:12 (EDT)
Hello computerman say you all look so sleepy.
Evalena 6
USA - Saturday, October 30, 2004 at 12:25:35 (EDT)
HAVE A SPOOKY HAPPY HALLOWENN TRICK OR TREAT
natalie 10 503 ps101
forest hills, ny USA - Friday, October 29, 2004 at 10:43:25 (EDT)
eat
daniel 5 ko13
USA - Friday, October 29, 2004 at 09:58:31 (EDT)
awfgty
sacha 5 k013
USA - Friday, October 29, 2004 at 09:52:03 (EDT)
awfgty
sacha 5 k013
USA - Friday, October 29, 2004 at 09:51:48 (EDT)
I kissed a boy.
diego 5 k013
USA - Friday, October 29, 2004 at 09:37:51 (EDT)
I love my mommy. kiss the rainbow. i want to spook you. i kissed
a mouse.
julia 5 k013
USA - Friday, October 29, 2004 at 09:32:19 (EDT)
can you put in grade 5 test prep for math?
Ivan S 9 PS101
forest hills, nyc USA - Thursday, October 28, 2004 at 17:42:14 (EDT)
dear computerman i love
isabelle 5 103
USA - Thursday, October 28, 2004 at 11:29:02 (EDT)
hello computerman can you give me a puppy
andy 7 103
USA - Thursday, October 28, 2004 at 11:24:16 (EDT)
himistrcputrman
michael 6 103
USA - Thursday, October 28, 2004 at 11:23:32 (EDT)
having a nice day computerman.
kathy 6 103
USA - Thursday, October 28, 2004 at 11:22:31 (EDT)
igparnan
carolina6
USA - Thursday, October 28, 2004 at 11:21:53 (EDT)
hello computerlady and computerman can you do a show for me
sebastian 6 103
USA - Thursday, October 28, 2004 at 11:19:58 (EDT)
Hello computer lady. I hope you are feeling well.
Isabelle 5 103
USA - Thursday, October 28, 2004 at 11:09:16 (EDT)
Taylor and louisa love each other and cats.
taylor.louisa5.5.
USA - Thursday, October 28, 2004 at 10:00:38 (EDT)
usaranpizza
michael5
USA - Thursday, October 28, 2004 at 09:54:03 (EDT)
taYLORLOVECAT.
tayor.5.ko31.
USA - Thursday, October 28, 2004 at 09:52:09 (EDT)
I am computer lady. amit has been very good. please buy her another
cat
amit 5 k031
USA - Thursday, October 28, 2004 at 09:37:32 (EDT)
ryan loves dinosaurs.
ryan 4 k031
USA - Thursday, October 28, 2004 at 09:32:14 (EDT)
i love my mommy
rebecca g. 4 k031
USA - Thursday, October 28, 2004 at 09:29:06 (EDT)
Hi, what a great website. Ours is not that nice but quite okay.
You can take a look on www.realschule-oker.de. Bye, Kurt.
Kurt, 37, RS Oker Bei der Eiche
Goslar, Lower Saxony, Germany - Thursday, October 28, 2004 at 07:08:40
(EDT)
Hi,these are Jannik,Jan,Martin and Hakan. We are 12 years old.We
live in Goslar.We like English.
Hakan,Jannik,Jan and Martin 12 6b Bei der Eiche
Goslar, Germany - Thursday, October 28, 2004 at 07:07:39 (EDT)
Hello,I am Laura,how old are you?I like Englisch and it is my favorite
sobject.Your website is great and New York is very great!I have two dogs.My
class is very cool.Our weather is not good and how is the weather in New
York? Bye Laura!
Laura 11 6b Realschool Oker by the Eiche
Goslar, Germany - Thursday, October 28, 2004 at 07:06:57 (EDT)
Hi we are sirin,julia and denise.What's your name? How old are you?
Have you got a PET? GOODBY
julia12, sirin13, denise12 class6b realschool
goslar, germany - Thursday, October 28, 2004 at 07:05:24 (EDT)
Hello I come from Goslar.Hi to New York from Germany.The weather
is not got today.
anna-isabelle 13years 6b realschool
goslar, germany - Thursday, October 28, 2004 at 07:05:10 (EDT)
Hallo, this is Althea Laveaux. Im 13 years old. Website is cool.
I come from Germany.How is the in New York? We have English and French.
6b Realschool bei der EICHE
Goslar, Germany - Thursday, October 28, 2004 at 07:04:58 (EDT)
Hello,I'm Anika.I'm 11 and how old are you? I like englisch. I haven't
got a pet. I think New York is great. My class is very nice. How the weather
in New York? Our weather is not so good.
Anika 11 6b Realschool by the Eiche
Goslar, Germany - Thursday, October 28, 2004 at 07:04:51 (EDT)
Hi,these are cihan and yannick.Here is the weather not good.we like
english and p.e.Iam 12 and yannick is 11.We live in oker.
cihan 12 and yannick 11 6b bei der eiche rs
Goslar, Germany - Thursday, October 28, 2004 at 07:02:43 (EDT)
Hi,from Germany these are Lara and Jaqueline. Your website is cool!
How is the weather in NY? Here is the weather cold! Love Lara and Jaqueline
Lara and Jaqueline 11 6b Bei der Eiche RS
Goslar, Germany - Thursday, October 28, 2004 at 07:01:49 (EDT)
Hi Iam Natalie.Your Website is cool!I like Horses,you too?
Natalie 11 6b Bei der Eiche
Goslar, Germany - Thursday, October 28, 2004 at 07:01:26 (EDT)
Hi, these are Sonja and Marylene We are from Germany.We just had
autum holidays.We let the house rocking.We wish that you can let the house
rocking,too. School is boring without us. Love, Sonja and Marylene
Sonja and Marylene 11 6b Bei der Eiche RS
Goslar, Germany - Thursday, October 28, 2004 at 07:01:20 (EDT)
Hi,how are you? The weather is nice.My name is Sarah from Germany!!!!
I like school.I am 11. And you? I have1 DOG!!!
Sarah 11y 6b RsOker
Goslar, Germany - Thursday, October 28, 2004 at 07:00:22 (EDT)
hi we are annabelle and tiana.your website is nice. we are 11 yeas
old.we say hello from germany.the weather is not cool,becaus it is cold.yours
annabelle and tiana
annabelle ,tiana 11 6b rs oker
goslar, germany - Thursday, October 28, 2004 at 06:58:48 (EDT)
hi my name is yasmin and my frind name is ikbal.we are from germany
.what is your name ? HOW OLD ARE YOU ?HALLO FROM GERMANY
ikbal and yasmin 6a rs oker
goslar, germany - Thursday, October 28, 2004 at 06:20:58 (EDT)
HELLO FROM GERMANY! THIS IS LUISA AND ALEX. OF CLASS 6A! ITS A VERY
GOOD WEBSITE*
alexandra luisa class 6a rs oker
goslar, germany - Thursday, October 28, 2004 at 06:19:26 (EDT)
Bonjour, this is Melissa from Oker in Germany. I am in the school
nice. Is your school nice? Needlework is grait. I like B.E. What class
you in.
Melissa 12 6a Realschule Oker
Goslar / Oker, Germany - Thursday, October 28, 2004 at 06:18:46 (EDT)
Hi, this is Rümeysa im from Germany. Im 12years old. I go in
Class6a. Whats your name. How old are you. What class are you.
Rümeysa 12 6a RS Goslar
Goslar, Germany - Thursday, October 28, 2004 at 06:18:43 (EDT)
Hi,my nameisTobias. I'm from Germany. I'm 12 years old. We say hello
from Germany.
Tobias,12,6a,RS Oker
Goslar, Germany - Thursday, October 28, 2004 at 06:18:15 (EDT)
Hi,my nameisTobias. I'm from Germany. I'm 12 years old. We say hello
from Germany.
Tobias,12,6a,RS Oker
Goslar, Germany - Thursday, October 28, 2004 at 06:18:06 (EDT)
Hello, my name is Marvin from Oker in Germany. I see a great website.I
love football." Hello!" from Germany.
Marvin 11 6a RS Oker-Germany
Goslar/ Oker, USA - Thursday, October 28, 2004 at 06:18:00 (EDT)
Hello,these are Vanessa,Julia and Natascha from Germany. We are
sitting in the Computer room. Your website is great.
Vanessa,Julia,Natascha 6a Realschule Oker
Goslar, Germany - Thursday, October 28, 2004 at 06:15:10 (EDT)
Hi, we are two girls from Germany. Our names are Sarah and Carmen.
What class are you in? We say "hello" from Germany!!! Love :Sarah and Carmen.
bye!!!!!!!!!!!!!!!!!
Sarah ,Carmen 6a Realschule Oker
Goslar, Germany - Thursday, October 28, 2004 at 06:14:15 (EDT)
Salut this is Yasmin from oker, germany. I am in the computer room.
i am in the class 6a. i like P.E. . What class you in?
Yasmin 12 6a RS Oker
Goslar, Germany - Thursday, October 28, 2004 at 06:13:45 (EDT)
Hi,our names are Patrick and Jonas We are from Goslar in germany
We say "Hello" from germany.
Patrick u. Jonas 13 and 11 6a RS
Goslar, Germany - Thursday, October 28, 2004 at 06:13:41 (EDT)
HI!! These are Nicolette and Ayse from Germany!!! Our class is fantastic
the number is 6a!!! Your Website is cool!!! English is our favourite!!
Love Nicolette and Ayse
Ayse and Nicki 12 and 11 6a RS oker
goslar/oker, / germany - Thursday, October 28, 2004 at 06:12:45 (EDT)
HI,i´am Marius from Germany. Nice, website! We are from Oker
School, class 6a in Germany. I´am in the fire brigade for teenagers!!!
by
Marius 11 6a RS Oker-Germany
Oker, / Germany - Thursday, October 28, 2004 at 06:12:17 (EDT)
Hello, i´m Adem from Germany.I see the website of you.That
is fantastic. How is your school? Like your teacher? Hello from Germany.
Adem 12 6a RS Oker-Germany
Goslar, / USA - Thursday, October 28, 2004 at 06:12:14 (EDT)
I used this site to get information for baudarlehen that i had in
my class. This is an excellent site for this information :)
Baukredit
de, - Thursday, October 28, 2004 at 05:09:30 (EDT)
I am inside the computer. I need help. Ha Ha Ha! I am computer woman.
Taylor 6 101 ps101
USA - Wednesday, October 27, 2004 at 20:52:54 (EDT)
hggggg nhgb jugt vnhhhjmghujjgy
,8,302,ps101
USA - Wednesday, October 27, 2004 at 17:53:00 (EDT)
dear mr.computerman,what part of the computer are you in.who gave
you that weird last name.
sabrina,8,303,ps101
USA - Wednesday, October 27, 2004 at 17:50:41 (EDT)
i like computerman.
sabrina,8,303,ps101
USA - Wednesday, October 27, 2004 at 17:47:01 (EDT)
I like halloween
Kevin 7 104
USA - Wednesday, October 27, 2004 at 11:24:05 (EDT)
I love Mr. Stein.
Ellen and Andrea 104
USA - Wednesday, October 27, 2004 at 11:24:02 (EDT)
iloveyou
keyra6104
USA - Wednesday, October 27, 2004 at 11:23:56 (EDT)
My name is Cameron. I am 6 years old. On halloween I will be Alice
in Wonderland. Ha Ha Ha
Cameron 6 104
USA - Wednesday, October 27, 2004 at 11:09:05 (EDT)
My name in Keyra. I love my Mommy. I hope she buys me a doggie.
Keyra 6 104
USA - Wednesday, October 27, 2004 at 11:05:49 (EDT)
Say I love miss steicke.
Bernie 7 104
USA - Wednesday, October 27, 2004 at 11:02:38 (EDT)
I like school. Do you? Did you copy someone's voice to make Computer
Man's voice?
Rachel 6 1-101
USA - Tuesday, October 26, 2004 at 17:00:28 (EDT)
lucy
isabella 5 101
USA - Tuesday, October 26, 2004 at 11:27:30 (EDT)
HELLOW MR.COMPUTERMAN. MY NAME IS TAYLOR.I AM INSAID THE COMPUTER.I
AM STUK IN HERE.HA HA HA !!!!!!!!!!!!!!!!!!!!!!!!!MY NAME IS LINDSAY TERJESEN.
I AM 7
TAYLOR 6 101LINDSAY 7 101
USA - Tuesday, October 26, 2004 at 11:25:31 (EDT)
Mr. Stin I like you.
Toma 6 101
NY, USA - Tuesday, October 26, 2004 at 11:25:23 (EDT)
do you now how to speak spanish?i do.hola.
rachel 6 101
USA - Tuesday, October 26, 2004 at 11:25:11 (EDT)
do you now how to speak spanish?i do.hola.
rachel 6 101
USA - Tuesday, October 26, 2004 at 11:25:09 (EDT)
do you now how to speak spanish?i do.hola.
rachel 6 101
USA - Tuesday, October 26, 2004 at 11:25:07 (EDT)
i like mister moss.
sylvie 6 101
USA - Tuesday, October 26, 2004 at 11:23:16 (EDT)
i love computer.
alisa 6 101
USA - Tuesday, October 26, 2004 at 11:23:14 (EDT)
i hit you
paul 6
USA - Tuesday, October 26, 2004 at 11:22:11 (EDT)
i hit you
paul 6
USA - Tuesday, October 26, 2004 at 11:22:10 (EDT)
Mr.Stin I like your web. It is fun.
Toma 6 101
USA - Tuesday, October 26, 2004 at 11:21:59 (EDT)
momanddadiloveyou
pierre6101
USA - Tuesday, October 26, 2004 at 11:21:01 (EDT)
Hello mom. I am inside the computer. I am stuck in her. Only kidding.
Ha Ha Ha
Pierre 6 101
USA - Tuesday, October 26, 2004 at 11:07:59 (EDT)
Hello my name is computer lady.
Isabella 6 101
USA - Tuesday, October 26, 2004 at 11:05:21 (EDT)
Hiya Mr.Stein!! Your a great teacher! Post Back Shirley
Shirley 10 602 PS101
Forest Hills, NY USA - Tuesday, October 26, 2004 at 10:27:53 (EDT)
I like school very much.I like riting about pokemon.
Marcelo age 6 class 201
USA - Tuesday, October 26, 2004 at 10:06:55 (EDT)
I am class 201.Mr.Stin is cool.Your class is grate.You are the best
teacher Mrs. Klien. Can we have extra play time?
claire 7 201
USA - Tuesday, October 26, 2004 at 10:00:02 (EDT)
I love my kitins. I love my mom and dad.
Sophia 201 101
USA - Tuesday, October 26, 2004 at 09:58:59 (EDT)
Ah who are you my mommy ah ah ah
Adie 7 201
USA - Tuesday, October 26, 2004 at 09:58:26 (EDT)
I am Max. I love my brother Adam.
Max 7 201
USA - Tuesday, October 26, 2004 at 09:58:22 (EDT)
we will laugh at you. ha ha ha
class201 Frewin ps101
USA - Tuesday, October 26, 2004 at 09:58:17 (EDT)
Ah who are you my mommy ah ah ah
Adie 7 201
USA - Tuesday, October 26, 2004 at 09:56:11 (EDT)
Hi we come in pease just kiding we do not ha ha ha ha
zaheer and chris7 201
USA - Tuesday, October 26, 2004 at 09:55:55 (EDT)
I like school.I like to read.
Gaby 7 201 P.S.101
USA - Tuesday, October 26, 2004 at 09:55:24 (EDT)
We are Eileen and Leah.We showed our moms the colors in motion
Leah and Eileen 7,201
New York City, NY USA - Tuesday, October 26, 2004 at 09:49:00 (EDT)
I do not have fun in school.Only on my bithday.
Emily 201 7 p.s.101
USA - Tuesday, October 26, 2004 at 09:46:37 (EDT)
I am Mr. Stein. I am stuck inside the computer. Help. Help. I am
only kidding. Ha Ha Ha Ha Ha
Mr. Stein
USA - Tuesday, October 26, 2004 at 09:35:55 (EDT)
My name is Dalia. I love my mommy and my sister. I like school.
Dalia 7 201
USA - Tuesday, October 26, 2004 at 09:33:29 (EDT)
QQ I enjoed the time on your site! Sincerly yours, with .......
Skiurlaub
de, - Tuesday, October 26, 2004 at 03:51:59 (EDT)
I like the way you set up that your info is the homepage, nicely
done. Q-Q
beamtendarlehen
de, - Monday, October 25, 2004 at 12:37:06 (EDT)
Hi mister stein.
Kats 8class 401 ps101
Queens, ny USA - Monday, October 25, 2004 at 10:16:12 (EDT)
HEllo my name is compter man. bishop and his classmates have bin
in a viedogame . lord of the ring
Nandini and Montaine 6 cllass 102
USA - Monday, October 25, 2004 at 10:04:53 (EDT)
HEllo my name is compter man. bishop and his classmates have bin
in a viedogame . lord of the ring
Nandini and Montaine 6 cllass 102
USA - Monday, October 25, 2004 at 10:04:52 (EDT)
Mr.dghrfgfhjurugtuyfeghurg uih7yu9b yhughy8f7yv uycrf ahuyidwfuyiiragyuygaguguggigigfhgvhfheufhuhj
jermal12 591
USA - Monday, October 25, 2004 at 10:04:40 (EDT)
hello my name is lil fip
matthew 11 591
Queens, 32 USA - Monday, October 25, 2004 at 10:04:23 (EDT)
Mr. Computerman. please say "Hello my name is Goku I can turn super
sayin. My brother can go super sayin 4 we figight.
jermal12 591
USA - Monday, October 25, 2004 at 10:00:38 (EDT)
hello my name is jemal and i eat my dog
matthew 11 591
Queens, 32 USA - Monday, October 25, 2004 at 09:56:53 (EDT)
computerman. "hello bishop and his class mates. All of you have
1 million dollors and a dragonball gt and goku. Sam Gohan cici and goten
and harry potter."
bishop10591
USA - Monday, October 25, 2004 at 09:51:52 (EDT)
hello my name is matthew davis how or you jamal and bishop
matthew 11 591
Queens, 32 USA - Monday, October 25, 2004 at 09:46:58 (EDT)
helo my name is pranav yester day iwent to nandini's birthday. andihd
fun.
pranav cllas102 6
USA - Monday, October 25, 2004 at 09:19:47 (EDT)
I go to toyrus I chase the running choclate bars.
Wenyi and Rowena 6 class 102
USA - Monday, October 25, 2004 at 09:18:16 (EDT)
dere mr ,stein i thick yore a apple
igli and sam 6 clss 102
USA - Monday, October 25, 2004 at 09:18:11 (EDT)
poop me up and up give poop and poop 102.
Krishen and Michael 6
ny, ny USA - Monday, October 25, 2004 at 09:16:28 (EDT)
dere mr ,stein i thick yore a apple
igli and sam 6 clss 102
USA - Monday, October 25, 2004 at 09:16:26 (EDT)
Julia and Evalena are selppy. we are funny so are you how are you
i am good.
Julia andEvalena 6 class102
USA - Monday, October 25, 2004 at 09:13:40 (EDT)
uehfuiuhdiahduwg ige87gwfu732g3uy2tyygwstw2yayyey2f21utyw1566hn66yrtryyrr
edwardcoees1026
USA - Monday, October 25, 2004 at 09:10:52 (EDT)
I saw googaa baby milk.you are funny.
Wenyi and Rowena 6 class 102
USA - Monday, October 25, 2004 at 09:09:19 (EDT)
Please say everyone in class 1 o 2 is cuckoo. I still like you.
Sam and Igly 6 class 102
USA - Monday, October 25, 2004 at 09:00:24 (EDT)
Hi Mr. Stein, My favorite color is yellow. In German, yellow is
Gelb. Gelber means yellow, blond or ginger. One of my ancestors had blond
or reddish hair and so we selected that as our family name.
Mr. Gelber, teacher, 2-203
USA - Saturday, October 23, 2004 at 21:06:58 (EDT)
Hi, Mr.stain is me paola from last years 6 grade. Russels sage is
the bestest junior high school ever .Can you please tell mrs.mass that
I'm doing very good in math. oh and I miss ps101. Now when you get to jnior
high school you have to be like adults and in kind of hard because I'm
steel a kid. I may go and see everybody .Please send Mrs.Mass the news.Bye
miss you all.
Paola,12
queens, NY USA - Saturday, October 23, 2004 at 18:29:28 (EDT)
ooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooool
hmhmn
USA - Saturday, October 23, 2004 at 16:47:23 (EDT)
hi stien. can i talk to computerman. I might faint if i dont.
Daniel 7 202 ps101
ny USA - Saturday, October 23, 2004 at 09:15:52 (EDT)
My moms favorite color is red and red means blude.
Melissa 7 202
USA - Saturday, October 23, 2004 at 07:27:04 (EDT)
Hollow Mr.Stine saterday I went to basketball it was so fun.
Melissa 7 202
USA - Saturday, October 23, 2004 at 07:19:14 (EDT)
my moms favorite is red
kamal 7 202
USA - Friday, October 22, 2004 at 19:00:02 (EDT)
"hello, how are you?"
kelly M 7 202 ps101`
USA - Friday, October 22, 2004 at 17:15:17 (EDT)
"hello, how are you?"
kelly M 7 202 ps101`
USA - Friday, October 22, 2004 at 17:15:15 (EDT)
Hi Mr.Stein! I made the website in Italian! I'm writing to you now
in Italian mode! Well Bye!
Mary Kathe S.
Forest Hills, NY USA - Friday, October 22, 2004 at 13:58:09 (EDT)
Pikachu is cute!(Is is true!)
Lucy Wei,10
Ms.Sawicki, USA - Friday, October 22, 2004 at 13:57:56 (EDT)
My Dad likes Green Green means Patent
Natalie 7 203
USA - Friday, October 22, 2004 at 13:17:34 (EDT)
My favorite color is purple.Purple means intelligant.
Adela 7 Cass203 P.S101
USA - Friday, October 22, 2004 at 13:16:30 (EDT)
Dear Mr.Stein, My name is Justin. My favorite color is yellow. It
is means young. Love, Justin
Justin 7 203 P.S.101
USA - Friday, October 22, 2004 at 13:16:25 (EDT)
My favorite color is purple.Purple means intelligant.
Adela 7 Ciass203 P.S101
USA - Friday, October 22, 2004 at 13:15:58 (EDT)
Hi Mr.Stein.My favorite color is purple.Purple means intelligant.
Abigail 7 203
USA - Friday, October 22, 2004 at 13:15:38 (EDT)
Hi Mr.Stein.My favorite color is purple.Purple means intelligant.
Abigail 7 203
USA - Friday, October 22, 2004 at 13:15:36 (EDT)
This is Yoni and I went to colors and I went to red and it ment
dinamic.
Yoni 71/2 203
USA - Friday, October 22, 2004 at 13:14:13 (EDT)
Hi my name is Ian. My favorite color is green. It means lucky.Ian
Ian 7 203
USA - Friday, October 22, 2004 at 13:11:49 (EDT)
My farout color is green.Green means lucky.
Sarah 7 203
USA - Friday, October 22, 2004 at 13:10:45 (EDT)
I LIKE THE COLOR BIUO.
nathalia 7 203
USA - Friday, October 22, 2004 at 13:10:42 (EDT)
I LIKE THE COLOR BIUO.
nathalia 7 203
USA - Friday, October 22, 2004 at 13:10:41 (EDT)
I LIKE THE COLOR BIUO.
nathalia 7 203
USA - Friday, October 22, 2004 at 13:10:22 (EDT)
MY FAVORITE COLOR IS GREEN, GREEN MEANS BALANCE.
Chibueze 7 203 ps101
USA - Friday, October 22, 2004 at 13:09:47 (EDT)
My name is Hana.My favorite color is red.Red means hot.
Hana 7 203
USA - Friday, October 22, 2004 at 13:09:44 (EDT)
you better tell me where computerman is or I will tell Mrs gonzalaz.Ha
Ha.
frank 7 203
USA - Friday, October 22, 2004 at 13:05:41 (EDT)
My favorite color is yellow. yELLOW MEANS CREATIVE.
Dan 56 203
USA - Friday, October 22, 2004 at 12:54:03 (EDT)
Mr. Computer man, Can you say "I went to Wisconsin and visited Natalie's
aunt CindY."
Natalie 7 203
USA - Friday, October 22, 2004 at 12:42:29 (EDT)
Mr. Computer man. Will you please say "I went on vacation in China."
Bodhi 7 203
USA - Friday, October 22, 2004 at 12:38:51 (EDT)
Mr. computer man. Can you say "Hello Mr. Stein".
Paulina 6 202
USA - Friday, October 22, 2004 at 11:10:02 (EDT)
I want Mr. Computer Man to say: Um hi class 301.
Justin 8 301
USA - Friday, October 22, 2004 at 10:19:59 (EDT)
lllove
ujki5ko13l
USA - Friday, October 22, 2004 at 09:54:47 (EDT)
i love my mommy.
julia 5 k013
USA - Friday, October 22, 2004 at 09:41:26 (EDT)
kiss the sky
Bennet 5 k013
USA - Friday, October 22, 2004 at 09:37:48 (EDT)
baufinanzierung Ein wirklich sehr Interessante Seite mit guten Informationen.
baufinanzierung
de, - Friday, October 22, 2004 at 04:25:58 (EDT)
WashingtonD.C was grate.I went to lots of musums.My favrote was
the Spy Musum.I did not see the White house.I saw all the memorials.
Claire 7 201 ps101
USA - Thursday, October 21, 2004 at 19:28:25 (EDT)
Vaterschaftstest Meinen Glückwunsch zum Internetauftritt. Eine
Webseite, die inhaltlich wirklich interessant und informative ist. Viel
zu bieten hat und userfreundlich zu navigieren ist.
Vaterschaftstest
de, - Thursday, October 21, 2004 at 08:45:18 (EDT)
Thanks Hallo, hier ist Karl aus Köln. Eure Webseite gefällt
mir sehr gut; schön zu sehen, dass sich jemand mit seiner Webseite
so viel Mühe gegeben hat.
Tanja
de, - Thursday, October 21, 2004 at 04:11:04 (EDT)
the yankees beterwin tonight!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
andrew 11 501 ps101
Forest Hills, ny USA - Wednesday, October 20, 2004 at 17:56:29 (EDT)
the yankees beterwin tonight!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
andrew 11 501 ps101
Forest Hills, ny USA - Wednesday, October 20, 2004 at 17:53:54 (EDT)
hi my name is laureta i am right in back of you mr.stein and that
ghost didnt scare me!
Laureta,11,601,ps101q
foresthills, ny USA - Wednesday, October 20, 2004 at 13:53:03 (EDT)
A pleasure to look at, go on with this! Kredite ohne Schufa
Kredite ohne Schufa
de, - Wednesday, October 20, 2004 at 12:43:52 (EDT)
Martin Diese seite ist genauso interessant wie informativ. Viele
Grüße!
Martin
de, - Wednesday, October 20, 2004 at 07:19:51 (EDT)
Do you like my picture Mr. Luke? MWAHAHAAAAAAAAAA!!!!!!!!!!!!
Shunella 11 602 P.S.101Q
Forest Hills, NY USA - Tuesday, October 19, 2004 at 18:32:15 (EDT)
I like the way you set up that your info is the homepage, nicely
done. Respekt!
Anja
de, - Tuesday, October 19, 2004 at 04:17:24 (EDT)
Hi Mr. Luke. I will never stop to annoy you.
Shunella 11 602 P.S.101Q
Forest Hills, NY USA - Monday, October 18, 2004 at 17:07:21 (EDT)
i put mr. stein together
edward 6 102
USA - Monday, October 18, 2004 at 08:54:29 (EDT)
Datenrettung Super Informationen verpackt in einem tollen Design.
Datenrettung
de, - Monday, October 18, 2004 at 02:52:57 (EDT)
hi how are you i am on aol bye
gabrielle
USA - Saturday, October 16, 2004 at 13:52:00 (EDT)
Partnersuche Hallöchen,durch zufall bin ich auf diese Seite
geraten,und ich finde sie sehr interessant und ansprechend. Macht weiter
so,ich schau auf jedenfall nochmal vorbei.lieben gruss von
Partnersuche
de, - Saturday, October 16, 2004 at 06:54:10 (EDT)
Anna Holly did a steamer!!!!!
daddy G
london, uk - Saturday, October 16, 2004 at 02:26:24 (EDT)
My Dad's favorite color is blue. Blue means technical
Justin 203 ps101
USA - Friday, October 15, 2004 at 13:14:31 (EDT)
hi anna maria love from D and joy and holly the dog,see u at christmas
xxx
dale hardcastle
london, UK - Friday, October 15, 2004 at 09:54:40 (EDT)
Vaterschaftstest In Zeiten von massenhaft Websitenmüll im Internet
eine sehr gut aufgebaute Website, nicht überdimensioniertes Design
und sehr gut recherschierte Hintergrundinformationen.
vaterschaftstest
de, - Friday, October 15, 2004 at 03:39:58 (EDT)
Mr. Stein, I solved your puzzle! Michael
Michael Jones, 5, K-012 ps101
New York USA - Thursday, October 14, 2004 at 21:11:26 (EDT)
Mr. Stein, I solved your puzzle! Michael
Michael Jones, 5, K-012 ps101
New York USA - Thursday, October 14, 2004 at 21:11:24 (EDT)
I like to play games, I liked your Christmas Card.
Moisey, 5 yo, K-3, PS220
Forest Hills, USA - Thursday, October 14, 2004 at 11:27:24 (EDT)
mr. stien i got 22.85 and 30.59 on dodge square. i was wandering
if i can help out like julian did, answer on tuesday when i have your class
or if i see you the rest of the week. bie!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!bie!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
shelby 9 402 101
foresthills, ny USA - Wednesday, October 13, 2004 at 21:00:28 (EDT)
ihaveapetfish
pierre6101
USA - Wednesday, October 13, 2004 at 18:44:20 (EDT)
hi mr. stein how are u doing ive did the crystle ball it was wrong!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1
justin 8 301 ps101
USA - Wednesday, October 13, 2004 at 15:39:44 (EDT)
Hey Mr. Stein, I'll see you at the meeting this afternoon. ~Mr.
Blum
Steve Blum, Computer Teacher, PS 205
Bayside, NY USA - Wednesday, October 13, 2004 at 09:49:30 (EDT)
Thanks! I enjoed the time on your site! Sincerly yours, with .......
Karl
de, - Wednesday, October 13, 2004 at 03:38:51 (EDT)
Dear Amy: I have just arrived Taipei, Taiwan. This is my home country
and your birth place. The first thing for me to do here is to write an
email to you/my lovely daughter. Wish you a fruitful computer class with
Mr. Stein. See you soon. Aaron Chen
Aaron Chen
Taipei, Taiwan - Wednesday, October 13, 2004 at 00:16:09 (EDT)
evil
nike
nike, nk USA - Tuesday, October 12, 2004 at 18:10:25 (EDT)
My grandma went to new york and farted real bad. Thats why there
is so much pollution.
nike
nike, nk USA - Tuesday, October 12, 2004 at 18:05:16 (EDT)
I put you together in the jigsaw puzzels!
kats t. 9 401 ps101
queens, ny USA - Tuesday, October 12, 2004 at 17:33:59 (EDT)
I love going on your computers.
Jonah Aguilar, 5, K011, PS101
Queens, NY USA - Tuesday, October 12, 2004 at 16:33:51 (EDT)
My mom's favorite color is light blue. What is yours, Mr. Stein?
Kats 8 401 ps101
queens, ny USA - Tuesday, October 12, 2004 at 14:03:34 (EDT)
Hi Mr. Stien!!!! How are you?
Kats 8 401 ps101
queens, ny USA - Tuesday, October 12, 2004 at 14:01:31 (EDT)
This is for you holo holo holooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo
Andy 6 cllass 101
USA - Tuesday, October 12, 2004 at 11:27:58 (EDT)
This is for you holo holo holooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo
Andy 6 cllass 101
USA - Tuesday, October 12, 2004 at 11:27:56 (EDT)
i like computer it is fun
rachel 6 101
USA - Tuesday, October 12, 2004 at 11:26:22 (EDT)
Andy i LOVE pokemon.
isabella 6 101
USA - Tuesday, October 12, 2004 at 11:24:57 (EDT)
Andy i LOVE pokemon.
isabella 6 101
USA - Tuesday, October 12, 2004 at 11:24:55 (EDT)
Andy i LOVE pokemon.
isabella 6 101
USA - Tuesday, October 12, 2004 at 11:24:53 (EDT)
Andy i LOVE pokemon.
isabella 6 101
USA - Tuesday, October 12, 2004 at 11:24:52 (EDT)
what color do you like
alisa 6 101
USA - Tuesday, October 12, 2004 at 11:23:16 (EDT)
i like computer it is fun.
rachel 6 101
USA - Tuesday, October 12, 2004 at 11:22:29 (EDT)
ilovemymommy
pierre6101
USA - Tuesday, October 12, 2004 at 11:22:15 (EDT)
My mom,s favret colr is green
Toma 6 101
new york, USA - Tuesday, October 12, 2004 at 11:20:57 (EDT)
Isabella do you like POKEMON.
Andy 6 cllass 101
USA - Tuesday, October 12, 2004 at 11:17:15 (EDT)
hello i am a picachu and i would like to say pokemon.
isabella 6 101
USA - Tuesday, October 12, 2004 at 11:17:06 (EDT)
hello i am a picachu and i would like to say pokemon.
isabella 6 101
USA - Tuesday, October 12, 2004 at 11:17:04 (EDT)
mae mams feibi kolor is red
leon 101
USA - Tuesday, October 12, 2004 at 11:14:58 (EDT)
myfriveritfrindiscris
paul
n.y cite, USA n.y - Tuesday, October 12, 2004 at 11:11:55 (EDT)
I will tell you the color my mom likes.
Leon 6 101
USA - Tuesday, October 12, 2004 at 10:58:40 (EDT)
Hey Mr.Stein. Whats up? I'm fine. I love your website. Its soooooooooooooooooooooooooo
specail to me that I think that its the best website that has ever been
created in the universe!
Emily 11 602 P.S 101 Q
forest hills, NY USA - Tuesday, October 12, 2004 at 10:49:56 (EDT)
betreiberlogos Super Informationen verpackt in einem tollen Design.
Betreiberlogos
de, - Tuesday, October 12, 2004 at 08:42:24 (EDT)
patrick will be spiderman max will be bob the builder
patrick and max 5 and 4 k011
USA - Tuesday, October 12, 2004 at 08:42:17 (EDT)
Hey there everyone! Hope that everything is doing fine! What a great
way to start off the new school year! Hi Mr. Stein!
Olivia, 12 701 JHS 190
Forest Hills, NY USA - Monday, October 11, 2004 at 15:13:37 (EDT)
Mr.stein how do you make a ftp server?
Andrew
USA - Monday, October 11, 2004 at 10:24:47 (EDT)
Ich finde Ihre Homepage sehr gut und fundiert. Die Informationen
helfen mir bei Hey! für den Aufbau einer Dokumentation vielen Dank
und weiter so. Dietmar
Hanno
de, - Monday, October 11, 2004 at 05:34:01 (EDT)
I like the Tooth Fairy Note
LALA 7 202
USA - Monday, October 11, 2004 at 00:43:34 (EDT)
I like the Tooth Fairy Note
LALA 7 202
USA - Monday, October 11, 2004 at 00:43:33 (EDT)
MESSAGE TO kathy 6 103: Wow you got a dollar for the tooth. Why
not try to print a Tooth Fairy Envelope from our website and place it under
your pillow. Maybe you will get MORE money. I will show you how in class.
BYE
Mr. Stein
USA - Sunday, October 10, 2004 at 13:01:54 (EDT)
My tooth fell out yestrday and I got 1 dollar from the tooth fairy!
kathy 6 103
USA - Sunday, October 10, 2004 at 09:27:01 (EDT)
My tooth fell out yestrday and I got 1 dollar from the tooth fairy
kathy 6 103
USA - Sunday, October 10, 2004 at 09:25:59 (EDT)
I whould like to say hey to A'kily harper and Macy McNair.
Laura,11,Mrs Gerow, Harlem Middle School
Harlem, GA USA - Saturday, October 09, 2004 at 14:39:49 (EDT)
my favorite color is red!
kathy 103
USA - Saturday, October 09, 2004 at 11:40:44 (EDT)
did you know my dad's favorite color is blue and green!
kathy 103
USA - Saturday, October 09, 2004 at 11:37:47 (EDT)
mr.stein my mom's favorite color is blue!
kathy 6 103
USA - Saturday, October 09, 2004 at 11:27:25 (EDT)
Hi Mr.Stein I am in Chicago.
Neil, 7, 201, PS 101
North Brook, IL USA - Friday, October 08, 2004 at 23:04:11 (EDT)
Dear Mr.Stien Iknow I am in 4th grade but my brother is in 1st.
I know how you do it. There are different holes in which you put different
coins.
Jessica 9 403
USA - Friday, October 08, 2004 at 20:23:53 (EDT)
I thank you for a wonderful site. You have done very good job. Hope
my Super it come out OK as we have very bad Internet in Mexico! Actually,
we have a very bad many things!
Marcel
de, - Friday, October 08, 2004 at 04:54:33 (EDT)
we love you mr.stein
david 7 103 kathy 6 103
USA - Thursday, October 07, 2004 at 13:03:36 (EDT)
Hallo, wir suchen für unsere neu Seite (handyklingeltöne)noch
schöne Berichte mit Informationen zu Hotels Fotos und Tipps zum Reiseland.
Persönliche erlebnisse aus dem Urlaub.
Handyklingeltöne
de, - Thursday, October 07, 2004 at 04:14:06 (EDT)
FROM WEBMASTER TO: Sabine and Handy from de,...Are you in Denmark?
Can you have a teacher email me at emaginatorium@aol.com ? I am happy that
you are enjoying my website. Perhaps we can have contests across the ocean?
Regards, Dan Stein, Technology Teacher and Webmaster
Mr. Sein, WebMaster
USA - Wednesday, October 06, 2004 at 20:16:36 (EDT)
I think that you seen my brother before. Have you Mr.Stine.
ps101 6 Evalena.
USA - Wednesday, October 06, 2004 at 18:41:59 (EDT)
Top. Sehr informative Seite. Vielen Dank für die Infos!
Sabine
de, - Wednesday, October 06, 2004 at 07:10:43 (EDT)
handy klingeltöne In Zeiten von massenhaft Websitenmüll
im Internet eine sehr gut aufgebaute Website, nicht überdimensioniertes
Design und sehr gut recherschierte Hintergrundinformationen.
handy
de, - Tuesday, October 05, 2004 at 05:12:28 (EDT)
Dear mrStine your class is grat loveEvalena.
ps101. 6 Evalena.
USA - Monday, October 04, 2004 at 19:50:19 (EDT)
Dear mrStin I love you love Evalena.
ps101.6 Evalena
unidstas., USA - Monday, October 04, 2004 at 19:43:10 (EDT)
Dear mrStin I love you love Evalena.
ps101.6 Evalena
unidstas., USA - Monday, October 04, 2004 at 19:43:10 (EDT)
gedichte Super Informationen verpackt in einem tollen Design.
Ingrid
de, - Monday, October 04, 2004 at 08:32:01 (EDT)
MESSAGE TO THE FATHER OF isabelle, 5, PS101, class 103 Thank you
so much!!!! mThe site you recommended "Colors" will be added to the EMAGINATORIUM!!
CONGRATULATIONS ON HAVING A DELIGHTFUL DAUGHTER!!! AND SHE'S JUST 5....WOW!
YOU ARE VERY LUCKY!!! OBVIOULSY A GREAT DAD TOO!!!
Mr. Stein
USA - Monday, October 04, 2004 at 06:25:00 (EDT)
Hi mr stein, this is isabelle's dad - I think you should should
check out this site - recently designed by an RIT student - I showed it
to isabelle and she thought it was very cool http://www.mariaclaudiacortes.com/
isabelle, 5, PS101, class 103
Forest Hills, NY USA - Sunday, October 03, 2004 at 21:03:38 (EDT)
berktrito dotirbnitrebtorbuyterotuorueourtoueotpnrvtuepnutreuruieuroeiruitruv9rutvoerveur
.ryo,ro[yorpyoprtoy[r
nuy5nun4nu4u, erhr5r USA - Sunday, October 03, 2004 at 11:39:32 (EDT)
super Great website, it was actually quite helpful however I was
wondering if you had anything pertaining to a particular topic, say for
instance Nature. I said it was real helpful for.
Axel
de, - Sunday, October 03, 2004 at 06:19:08 (EDT)
i am in russell sage
ian f. russell stage
USA - Friday, October 01, 2004 at 16:10:15 (EDT)
Whats my password?(talk secretly)
Maya 8 303
USA - Thursday, September 30, 2004 at 19:59:17 (EDT)
Whats my password?(taik secretly)
Maya 8 303
USA - Thursday, September 30, 2004 at 19:58:16 (EDT)
Informative professional site, whatmore can i say!! If you like
Respect! ........
Ingrid
de, - Thursday, September 30, 2004 at 12:31:02 (EDT)
Dear Ian, Hi. The boys and girls in our class miss you. It's not
the same without you. I changed everyone's seat because the class likes
to talk. It didn't help though. The Bronx was the most talkative. Brooklyn
was good most of the time. Queens liked to chat alot. Manhattan, your table
is still a quiet table. Our experiment of separate boys and girls tables
did not succeed. We're all mixed up now. We're just New Yorkers now living
in the boroughs. See you soon. Mr. Gelber
Mr. Gelber 2-203
USA - Wednesday, September 29, 2004 at 17:40:54 (EDT)
Dear Ian, Hi. The boys and girls in our class miss you. It's not
the same without you. I changed everyone's seat because the class likes
to talk. It didn't help though. The Bronx was the most talkative. Brooklyn
was good most of the time. Queens liked to chat alot. Manhattan, your table
is still a quiet table. Our experiment of separate boys and girls tables
did not succeed. We're all mixed up now. We're just New Yorkers now living
in the boroughs. See you soon. Mr. Gelber
Mr. Gelber 2-203
USA - Wednesday, September 29, 2004 at 17:40:40 (EDT)
Dear Ian, Hi. The boys and girls in our class miss you. It's not
the same without you. I changed everyone's seat because the class likes
to talk. It didn't help though. The Bronx was the most talkative. Brooklyn
was good most of the time. Queens liked to chat alot. Manhattan, your table,
is still a quiet table. Our experiment of separate boys and girls tables
did not succeed. We're all mixed up now. We're just New Yorkers living
in the boroughs. See you soon. Mr. Gelber
Mr. Gelber, 2-203, P.S.101
USA - Wednesday, September 29, 2004 at 17:39:51 (EDT)
Ian, The boys and girls of class 2-203 miss you! It is not the same
without you. Everyone can't wait until you return. I changed everone's
seat because all the children were chatting constantly. See you soon! Mr.
Gelber
Mr. Gelber, 2-203, P.S. 101
USA - Wednesday, September 29, 2004 at 17:28:19 (EDT)
hi mr.stein.
rachel
USA - Wednesday, September 29, 2004 at 14:29:08 (EDT)
hello hello hello hello hello helhello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello vvhello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello vvvhello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello vhello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello vvhello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello vvhello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello vvvvvhello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello vhello hello hello hello hello hello hello hello hello
hello vhello hello hello hello hello hello hello hello hello hello vhello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
hello hello hello hello hello hello hello hello hello hello hello hello
lo hello hello hello hello
Lauren & Jen 601
Forest hills, NY USA - Wednesday, September 29, 2004 at 13:53:48 (EDT)
Hi Mr. Stein, you just gave us our passwords. Bye
Diana H. and Hannah S. 601 101 11
NYC, ny USA - Wednesday, September 29, 2004 at 13:53:10 (EDT)
hi mr.stein we are right at the side of you.hi ps101! i love gym
we have gym in about 5 min. whoooohooooooo
Laureta and Lissette
new york, ny USA - Wednesday, September 29, 2004 at 13:49:15 (EDT)
Huh?
Shunella 11 602 P.S.101Q
Forest Hills, NY USA - Monday, September 27, 2004 at 23:32:18 (EDT)
I'm so bored...hello?! Hello?! Anybody alive making guestbook messages
other than me? HELLO?! Hi.
Shunella 11 602 P.S.101Q
Forest Hills, NY USA - Monday, September 27, 2004 at 23:31:47 (EDT)
Hey people. Ze Internet is a fascinating place, isn't it? Have fun
surfing the waves of the brainwashing Internet! OK, whatever, bye.
Shunella 11 602 P.S.101Q
Forest Hills, NY USA - Monday, September 27, 2004 at 23:30:51 (EDT)
To Mr stein My mom beat me .
Jessy 7 302
usa, USA - Monday, September 27, 2004 at 21:47:22 (EDT)
My mom beat me
Jessy
uusa, USA - Monday, September 27, 2004 at 21:36:58 (EDT)
My mom won at matho.
Raquel S. Age9 Class401 P.S.101
USA - Monday, September 27, 2004 at 17:46:22 (EDT)
MR. STIEN i beat my mom and my time was 139 and 0 misses. That game
was exsiting.
melanie 8 302
new york, USA - Monday, September 27, 2004 at 16:26:27 (EDT)
Hi I realy like the site
elizabeth
ny, ny USA - Saturday, September 25, 2004 at 10:02:57 (EDT)
Hello Mr.Stein this is Tatyana from class 603 last year, just syaing
hi!!!!!!!!!!
Tatyana 12 Russell Sage
new york, NY USA - Friday, September 24, 2004 at 19:33:02 (EDT)
Mr.Stein I am in a children hospital. I can't wait to be at shool
with all my friends. I miss shool. love Ian Ryding Ian
Ian 7 203 ps101
USA - Friday, September 24, 2004 at 13:51:36 (EDT)
MR. STIEN I LOVE YOUR CLASS IT IS FUN TO PLAY AT YOU LET US PLAY
ON YOUR COMPUTER
CHIBUEZE 7 CLASS2 203
USA - Friday, September 24, 2004 at 13:12:39 (EDT)
Dear Mr.Stein, I hope you had a nice Summer vacation. I went to
Hawaii. Welcome back to school. Love, Justin
Justin 6 203 P.S.101
USA - Friday, September 24, 2004 at 13:08:56 (EDT)
I LKIE MY MOM
ALI 9203 ps101
USA - Friday, September 24, 2004 at 13:07:54 (EDT)
I like the invent a machine
Frank 7 203 ps101
USA - Friday, September 24, 2004 at 13:03:26 (EDT)
I liked rap music
marquise 8 202 ps101
USA - Friday, September 24, 2004 at 11:30:06 (EDT)
MRS. KOATZ: Is it true that you downloaded Gabe's message from our
website onto your Ipod? Do you think he will become the president?
Mr. Stein
USA - Friday, September 24, 2004 at 10:19:59 (EDT)
HELLO REIKO,Grade 4 Are you talking to Mr. Stein?
MR. STein
USA - Friday, September 24, 2004 at 06:53:23 (EDT)
Cool site, I'd say hi and best wishes to You, for more Thanks!
Hanno
de, - Friday, September 24, 2004 at 04:21:03 (EDT)
HALLO PEOPLE OF THE WORLD!!!!!!! HOW ARE YOU!!!!!!!!
Shunella 11 602 P.S.101Q
Forest Hills, NY USA - Thursday, September 23, 2004 at 19:42:07 (EDT)
The mystery person is easy. Maybe I shouldn't tell the answer to
all those people still PONDERING over it.
Shunella 11 602 P.S.101Q
Forest Hills, NY USA - Thursday, September 23, 2004 at 19:37:33 (EDT)
2-4u I enjoyed this site very much and have taken away a better
insight. I will recommend this site to everyone I know. More people should
step into.
moppel
de, - Thursday, September 23, 2004 at 04:50:16 (EDT)
Hi Mom!
Taylor C. 11 601 P.S.101q
For, NY USA - Wednesday, September 22, 2004 at 14:03:58 (EDT)
hiiiiiiiiiiiiiiiiii
hi
hi, hi USA - Wednesday, September 22, 2004 at 14:01:47 (EDT)
you are the best computer teacher ever.
moe and melannie
USA - Wednesday, September 22, 2004 at 13:12:44 (EDT)
Dear Mrs. Steinke, My favorite part was chocolate
Danny 6 104 ps101
USA - Wednesday, September 22, 2004 at 11:02:38 (EDT)
Sorry I bothered you again , i just miss you so much.
Reiko 9 403
NY, NY USA - Wednesday, September 22, 2004 at 10:40:56 (EDT)
I aleady miss you and I wanted to ask you where you went for summer.
Reiko 9 403
NY, NY USA - Wednesday, September 22, 2004 at 10:37:45 (EDT)
I wanted to know what you did this summer ? when I was at Calgary;Canada
I missed you so mmmmmmmmmmuuuuuuuuuuccccccchhhhhhhhhh.
Reiko 9 403
NY, NY USA - Wednesday, September 22, 2004 at 10:34:35 (EDT)
Dear Gabby, I loved your message, Tell me if you found the mouse
dancing? Write me another message.
Mr. Stein 56 k---012 ps101
USA - Wednesday, September 22, 2004 at 09:28:59 (EDT)
Yo, people. I'm having a blast...doing nothing. What are you people
doing out there? Bored? Happy? Sad? Mad? Excited? Etc?
Shunella 11 Class 602 P.S.101Q
Forest Hills, NY USA - Tuesday, September 21, 2004 at 17:51:29 (EDT)
HINDI is the name for the bird "turkey" in turkish language.. and
according to an old legend about an itinerant/traveller who were trying
to travel from india to america in the past.. and he got a turkey bird
with him during his travel.. and when he came to Turkey on his way.. he
got hungry and he ate this turkey bird and he shared the meat with some
Turkish people too..and they liked this bird's meat taste very much and
then they named this bird hindi.. because the man was from INDIA which
comes from the word HINDISTAN in Turkish language.. and then this traveller
married with a Turkish woman and went to America and he settled there..
and they were the first pioneers of the original old american indians.
ehem thank you.. myauboy@yahoo.com http://kan.ca.tc http://www.cgs.com.tr/kan/kan.htm
to hear my voice.. dial this number.. 00905323120576 Kaan.. cheers..
KaaN 28
istanbul, Turkey - Tuesday, September 21, 2004 at 05:52:41 (EDT)
i want to touch a whale. http://kan.ca.tc http://www.cgs.com.tr/kan/kan.htm
KaaN 28
istanbul, Turkey - Tuesday, September 21, 2004 at 05:40:22 (EDT)
Dear Mr. Stein, Thank you so much for replying. The some things
that are cool about India are: 1) I am learning a new language. It is called
HINDI. 2) There are so many people and cars everywhere. 3) I have even
seen cows on the street waiting to cross the road. 4) I can get all different
kinds of colorful Indian dresses, bracelets, bindis here. I miss you all
and love you too, Krishangi.
Krishangi, 7, 2nd
New Delhi, India - Monday, September 20, 2004 at 09:17:39 (EDT)
FROM MR. STEIN TO Gabby, 5, K-012, P.S. 101 - I am proud of you.
You made it to our website from home. When you come to class I will show
you how to get to the mouse and the alien. Then you can try again from
home. See you in class
Mr. Stein
USA - Sunday, September 19, 2004 at 20:57:41 (EDT)
Dear Mr. Stein, I am in India now. I miss you and my friends a lot.
Can you please say 'hi' to Dalia, Nathalia and Mai of grade 2. You can
send me a message in my mom's email add: geetima_dk@yahoo.com I will write
to you again later. Love, Krishangi.
Krishangi, 7, 2nd
India - Sunday, September 19, 2004 at 04:31:19 (EDT)
Hi Mr.Stein! Sorry for not keeping in touch for so long. My old
computer could not send my messages and whenever I want to send one, usually
it's really late. Oh yeah, and Andrew got into Art for talent.There were
no computer classes for talent even though there are two computer rooms.
I don't know what talent I'm going to get this year yet. Oh well. I hope
you are doing great right now. We miss you (Andrew and me). Bye
Sylvia 13 Russel Sage
Forest Hills, N.Y. USA - Saturday, September 18, 2004 at 22:58:00 (EDT)
handy klingeltoene Excelente Idee alle diese Informationen zu presentieren.
Handy Klingeltoene
de, - Saturday, September 18, 2004 at 05:02:41 (EDT)
Hi, Mr. Stein, I really, really like the computer and I got to your
web site! I really liked the dancing alien and the dancing mouse but I
couldn't find them. Love, Gabby (typed by Mom)
Gabby, 5, K-012, P.S. 101
USA - Friday, September 17, 2004 at 09:51:02 (EDT)
Hi Mr.Hyman can u please put me in the email list and my email is
surfwaves35@aol.com
Maria Pia S.
Forest Hills, NY USA - Wednesday, September 15, 2004 at 20:15:04 (EDT)
Hi Mr. Stein.......if this is class K-012 hi to my little brother
John!!!!!!!! Mr. Stein teach him as much as you taught me!!!!!!!!! Have
fun!!!!!!!!!!! ~Sarah
Sarah, 12, 807, Russell Sage
Forest Hills, Ny USA - Wednesday, September 15, 2004 at 19:34:30 (EDT)
i like the optical illusions.
alena 10 501
nyc, ny USA - Wednesday, September 15, 2004 at 18:34:53 (EDT)
i like the optical illusions.
alena 10 501
nyc, ny USA - Wednesday, September 15, 2004 at 18:34:42 (EDT)
keep nnaaaaaaaaaaaaaaaaaa na guyyyyyyyyyyyyyy
abbey 419 university togo
lome, imo togo - Wednesday, September 15, 2004 at 05:22:30 (EDT)
Oh my go it's my first time
RaktimG CL401
USA - Tuesday, September 14, 2004 at 14:03:27 (EDT)
Hey Mr S!! had a good first day of skool? i made my own website
and it's still under construction!! it's www.jonettejeter.bravehost.com
plz sign my guestbook!!
Jonette
USA - Monday, September 13, 2004 at 15:29:21 (EDT)
rrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr
rrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr
Raymond8ps101
USA - Monday, September 13, 2004 at 13:02:19 (EDT)
HI I AM AT SEA WORLD . RIGHT NOW I AM GOING TO EAT A GIANT STINGRAY
,AHHHHHHHHHH ITS ALIVE ITS GONNA EAT ME GOT TO GO.SEEYA AAHHHHHHHHHHHHHHHHHHHHHHHHHHHH.
MORGAN
USA - Monday, September 13, 2004 at 10:43:39 (EDT)
Hello Mr.Stein!Good-byeMr.Stein!
John Class 401
USA - Monday, September 13, 2004 at 10:37:32 (EDT)
What's up Stein?! See ya. how was your summer? mine was great!!!!
Paula S. and Raquel S. 401
USA - Monday, September 13, 2004 at 10:37:30 (EDT)
Hi.
marcos401
USA - Monday, September 13, 2004 at 10:36:27 (EDT)
HAY WHATS UP HOW YOU DOING .I AM AT MY GRANDMA . KNOCK KNOCK SAY
WHO THERE SAY IT FINE IF YOU DONT ANSWER BYE SEE YA.
JESSICA S.
USA - Monday, September 13, 2004 at 10:36:12 (EDT)
I am having a good day back.
Jackson 401
USA - Monday, September 13, 2004 at 10:34:14 (EDT)
Hi Mr.Stein.
kats T. 8 401 ps101
NYC, ny USA - Monday, September 13, 2004 at 10:28:27 (EDT)
Hi there
Myra X. 401
USA - Monday, September 13, 2004 at 10:27:29 (EDT)
dear Mr.stein I like the frst day school in I going your class now.
jermal 1307306 101
new york, USA - Monday, September 13, 2004 at 10:00:16 (EDT)
DEAR MR:STEIN HOW ARE YOU TODAY I KNOW I AM: BE A GOOD TEA CHER
bishop;fmt
newyork city, newyork USA - Monday, September 13, 2004 at 09:56:04
(EDT)
i am in computer class with Mr.Stein.
David S.
NewYork City, USA - Monday, September 13, 2004 at 09:51:21 (EDT)
i am in computer class with mr.stein
matthew d.
New york, USA - Monday, September 13, 2004 at 09:51:11 (EDT)
I am in computer class.
Matthew D.
USA - Monday, September 13, 2004 at 09:30:16 (EDT)
i love my school
desmond john
forest hill, ny USA - Friday, September 10, 2004 at 22:20:18 (EDT)
Man Im Really Getting Bored............ why Am I Doing This?hmmmmmmmmmm........
why am i doing this????HEY!! WHY IS MY MOUSE MOV ING TO SUBM AHHHHHHHHHHHHHHHHHHHH
NOOOOOOOOOOOOOOOOOOOOOOOO DONT DO IT!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!NONONONONONONO!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Brian C. 9 401
Hong Kong, China - Friday, September 10, 2004 at 22:06:44 (EDT)
hi i im a teen titen my name is starfier i want to say hello kitty
isabella 6 1-101
USA - Thursday, September 09, 2004 at 12:12:45 (EDT)
Hi Mr. Stein!!! I was in Old Saybrook C.T! It was soooooo fun! And
I had my 10th birthday on the 12th of August! See you Soon!
Mary Kathe S. 10 501 ps101
Old Saybrook, C.T. USA - Thursday, September 09, 2004 at 11:20:54 (EDT)
wat up mr. stein how u been im going to russel nxt yrs hope i can
come back to c u people
shenequewa 603
queens, ny USA - Wednesday, September 08, 2004 at 20:30:57 (EDT)
Hello everyone! Right now I am in Paris. My family and I just came
here from London and in two days my family and I are supposed to go to
Italy for a wedding. After the wedding my family and I will go to London
once more and then go back to New York. I am having a great time so far
on my vacation and I hope to see everyone soon!!
Jordan Knight 9 403 P.S. 101
Paris, France - Monday, September 06, 2004 at 16:24:59 (EDT)
IHAVE A HOUSE IN THE MOUNTAINS. THERE ARE BEARS HERE. I SAW 2 OF
THEM.
SEBASTIAN GOMEZ
FOREST HILLS, NY USA - Monday, September 06, 2004 at 08:04:55 (EDT)
MESSAGE FROM MR. STEIN TO EVERYONE!!! I hope everyone is reading
all the messages to this guestbook from students on vacation. Some students
are just 6 years old. ....Bring in pictures of you and your family during
your summer vaction. We can post them to the map of the United States and
to the map of the world. Perhaps we can write stories about the best part
of our summer vacation. Should we make a newsletter for all to see? I miss
you all. See you soon.
Mr. Stein
USA - Sunday, September 05, 2004 at 07:57:34 (EDT)
Dear Mr. Stein, I am in Little Chute, Wisconsin. It is very hot
out here. I am visiting my aunt Cyndee's 2nd grade classroom. I am having
a very fun time. I hope you are having a fun time too. from Natalie
Natalie 7 203
USA - Friday, September 03, 2004 at 16:34:37 (EDT)
Hi Mr.Stein I hope you had a great summer,because I did and I am
going to tell you all about it. This summer I went to South Caronlina to
see my sisters and my mother.But the amazing thing I did was took a plane
from South Caronlina to New York. I was very nervous because I was on the
plane by myself.It only took 1hour and 20minutes to get to New york. It
was fun. See you soon. Candice
Candice Allen ,11,503 P..S101
Queens, NY USA - Friday, September 03, 2004 at 12:52:50 (EDT)
Dear Mr. Stein, Sorry I'd like to add ... if you can give me any
information on how to get the year book of 1976 Graduates, appreciate it
if you can email it to me to ejansen@adb.org. I'm really looking forward
to receive information on the year book. Best regards, Endang
Endang Suroto, PS 101
Jakarta, Indonesia - Friday, September 03, 2004 at 06:03:29 (EDT)
Dear Mr. Stein, I graduated from PS 101 in 1974. Would it be possible
to get the year book? I'm now in Indonesia. I just can't forget those happy
years at PS 101. Best regards, Endang
Endang Suroto,
USA - Friday, September 03, 2004 at 05:00:44 (EDT)
hi mr stein i am comeing to school this moth i hop to see you on
sept 13 04 i hop to see all my friends from 5 grade and all my 5 grade
teacher .
Cecile 11 501 ps101
USA - Thursday, September 02, 2004 at 14:36:17 (EDT)
I went to Hershey Park - It was really fun - Especially going to
Chocolate World.I didn't go on this ride but,The Storm Runner a Roller
Coaster ride went from 0 to 72 miles per hour in 72 seconds - Just 48 seconds
later the ride was over.It was cool
josh 10 401 ps101
lebanon, pa USA - Thursday, September 02, 2004 at 10:14:13 (EDT)
Hey i can't believe that i survived my first day of middle school!!
Jonette
USA - Wednesday, September 01, 2004 at 16:06:00 (EDT)
I MISS PS101.
megan 7 203
ny USA - Wednesday, September 01, 2004 at 13:35:38 (EDT)
i'm having a great time at the Quality Inn. Tomorrow I'm going to
Hershey Park and spending the whole day there. I'm going on runs, playing
games and eating food.Of course I'm going to have fun. You should come
here too,
joshua solomon 10 401
lebanon, pa USA - Tuesday, August 31, 2004 at 22:18:03 (EDT)
Hey Mr. Stein!! i can't believe it!! my school starts on Wednesday!!!
September 1st!! thats so early i'm really nervous.....wat can i do to let
myself know that i will have a good time?
Jonette
Milford, CT USA - Monday, August 30, 2004 at 08:38:34 (EDT)
Dear Dan, I hope you had a restful and fun-filled summer. I know
you have been also adding to your bag of computer "tricks"(smile). I AM
IMPRESSED with this guest book; I really need one. Talk to you soon, I
hope. Miss you! Veronica Newton
PS 30
Queens, NY USA - Sunday, August 29, 2004 at 17:03:16 (EDT)
Dear Dan, I hope you had a restful and fun-filled summer. I know
you have been also adding to your bag of computer "tricks"(smile) Miss
you! Veronica Newton
PS 30
Queens, NY USA - Sunday, August 29, 2004 at 17:02:07 (EDT)
Dear Dan, I hope you had a restful and fun-filled summer. I know
you have been also adding to your bag of computer "tricks"(smile Miss you!
Veronica Newton
PS 30
Queens, NY USA - Sunday, August 29, 2004 at 16:54:34 (EDT)
i wish all good luck 2 students that are goin to be at ps 101 at
9/13/04 and have fun in ps 101 plus dont get into fights just be kind to
every one esle
marcelo
new york, US USA - Saturday, August 28, 2004 at 20:51:29 (EDT)
Hi everyone. Get ready for school. Hahahahaha
Mr. Stein
USA - Thursday, August 26, 2004 at 11:10:09 (EDT)
Hi everyone. Get ready for school. Hahahahaha
Mr. Stein
USA - Thursday, August 26, 2004 at 11:10:05 (EDT)
hi mr stein i miss everyone since now im goin to russell sage hope
i'll see everyone esle in sage and i just got bak in central america so
i'll see yousoon and the rest of the people i know
marcelo
queens, us USA - Tuesday, August 24, 2004 at 22:15:49 (EDT)
it is funny
michael A
ny, ny USA - Saturday, August 21, 2004 at 17:04:18 (EDT)
i like this site it is funny and nice
brittany a
ny, ny USA - Saturday, August 21, 2004 at 17:02:29 (EDT)
MESSAGE TO JONETTE: Try www.flamingtext.com Be Well. Good luck in
CT. I will miss you!!! Mr. Stein
Mr. Stein
USA - Thursday, August 19, 2004 at 12:22:45 (EDT)
dear Mr.stein right know i am with my mom at her job. i like how
you plan things for us to do. i liked the who am i thing. because i liked
making the people. i like ps101 alot i been here since precay.
alana 8 201 ps101
USA - Thursday, August 19, 2004 at 11:19:36 (EDT)
dear Mr.stein right know i am with my mom at her job. i like how
you plan things for us to do. i liked the who am i thing. because i liked
making the people. i like ps101 alot i been here since precay.
alana 8 201 ps101
USA - Thursday, August 19, 2004 at 11:19:36 (EDT)
mr.stein how do i get to make my pictures move loke we did last
year
shenequewa
queens, ny USA - Monday, August 16, 2004 at 12:13:25 (EDT)
last year i was in your computer class on fridays after the 6th
grade lunch . i was in the same class with sonny , irving ,tatyana and
ramzi. but now im goig to russel sage im going to miss every one and i
hope to see you guys again some time next year. :)
shenequwa russel sage
queens, ny USA - Monday, August 16, 2004 at 12:04:36 (EDT)
hey mr stein!...umm....do u remember that website where u can make
ur own animating txt? can u give me the link...coz i don't remember it!
jonette
USA - Monday, August 16, 2004 at 11:21:47 (EDT)
Pop I pop poppop poppop pop
ko13 ps101
ny, ny USA - Sunday, August 15, 2004 at 17:25:24 (EDT)
Hi. Check the link you sent me. Whe I went there it asked for a
password. We will miss you in September. :( Mr. Stein
Mr. Stein
USA - Saturday, August 14, 2004 at 07:17:58 (EDT)
What Password?
Jonette
USA - Thursday, August 12, 2004 at 22:12:34 (EDT)
MESSAGE TO : JONETTE, I would love to see your website. I hope you
have your parents' permission. You may email me the password at: emaginatorium@aol.com.
Leave me a message here (without the password). I check this often We will
miss you in September, :( Mr. Stein
Mr. Stein
USA - Thursday, August 12, 2004 at 21:29:09 (EDT)
Hey Mr Stien i made my own website!! it's here http://www.xanga.com/home.aspx?user=YaNkeEsCrAzY2
Jonette Jeter
USA - Thursday, August 12, 2004 at 10:53:38 (EDT)
Hope everyone is having a GREAT summer!
Mr. Stein
USA - Wednesday, August 11, 2004 at 09:07:59 (EDT)
MESSAGE TO: krishen 6 ko13, Thank you for your message. I look forward
to teaching you alot this year. It will be fun. I bought 2 new CRAZY lamos
for the classroom. ----MESSAGE TO: Sarah, 807 Russell Sage: Miss you....
I expect that you will be sending me COOL things for the website. I hope
you can help me with my Graduate Program. I think you will enjoy it. You
will learnm how to make a site!! The course is on Wed at PS 101. Have a
Great Summer
Mr. STein
USA - Monday, August 09, 2004 at 21:54:25 (EDT)
Hello Mr Stein, I hope you are having a great summer.
krishen 6 ko13 ps1o1
ny, usa USA - Monday, August 09, 2004 at 20:28:20 (EDT)
Hello Mr Stein, I hope you are having a great summer.
krishen 6 ko13 ps1o1
ny, usa USA - Monday, August 09, 2004 at 20:28:19 (EDT)
Hi Mr. Stein!!!!!!!!!!!!!! Im having a great summer so far!!!!!!!!!!!!
I hope yours is great too and I am constanly checking the site to see what
you have added!!! My mom says hi!!!!! -Sarah
Sarah, 807 Russell Sage
Forest Hills, NY USA - Sunday, August 08, 2004 at 21:41:17 (EDT)
Catherina!! how r u?? i miss u so much! when are u coming bak from
ukraine? if u'r coming bak b4 september... i can plan a play date here
w/ u and alize!!..i miss u!! EMAIL ME!!!
Jonette Jeter
USA - Sunday, August 08, 2004 at 18:40:24 (EDT)
Hi people! I'm in China! Tomorrow I will be returning to Shanghai,
and next week to NYC! In Qingdao, it is 24-29 degrees CELSIUS, which is
about 60-80 degrees fahrenheit, i think. in Shanghai, it is 30-40 degrees,
more than 100 degrees fahrenheit! China is experiencing a major heat wave!
I hear that it is really cold in New York. I missssss PS 101, all my friends,
and Puggie! CJ
CJ, 11, (going to be)601, PS 101Q
Qingdao, ??? China - Thursday, August 05, 2004 at 00:23:46 (EDT)
Thanks Mr. Stein for a wonderful year
Catherina Y. 11 was in 602 PS101
Kiev, ------ Ukraine - Tuesday, August 03, 2004 at 20:54:49 (EDT)
Hi Mr.Stain.I hope i see you next year, because I'm going to junior
high schoo. If you see the six grade teachers and mrs.paul say hi to them.
Paola ,11 602
forest hills, ny USA - Tuesday, August 03, 2004 at 15:16:05 (EDT)
hi! I'm all the way in Grece its really fun here. my cousins and
Iget to the beach every day.see you in new york!
claudia b.10 403 ps 101
nyc, ny USA - Sunday, August 01, 2004 at 12:32:53 (EDT)
MESSAGE TO Jonette -Milford, CT USA - Sorry you moved :( , Can you
get creative on the computer. Make a web site..... Tell us about it. MESSAGE
TO: Andy and Steward,11 and 8,ps101, Don't let yourself be bored. Build
find a GREAT website we can add to The Emaginatorium. Get permission from
MOM.... MESSAGE TO AMY: CAN YOU MAKE ME AN ANIMATION???? Email it to EMAGINATORIUM@AOL.com.
HAVE A GREAT SUMMER.. Hey, I hope everyone's having a nice summer! See
you in September! Diana Age 11
Mr. Stein
USA - Sunday, August 01, 2004 at 07:10:27 (EDT)
Hey every1!! how's ur summer?...i guess my summer is really boring!!...coz
i have 2 stay home most of the time..bcoz my parents have 2 work on their
brand new jobs!
Jonette
Milford, CT USA - Friday, July 30, 2004 at 14:59:27 (EDT)
hi we're at the the library. How are you Mr.Stein, we are fine.
We're bored to death, what should we do? please answer us!
Andy and Steward,11 and 8,ps101
nyc, USA - Thursday, July 29, 2004 at 16:56:45 (EDT)
Hey, I hope everyone's having a nice summer! See you in September!
Diana Age 11
NYC, NY USA - Tuesday, July 27, 2004 at 17:37:46 (EDT)
Hello Mr.Stein and everyone else!! Great summer. But, I havn't traveled
out of New York City, from when the 2004 school semester ended 'till now,
July, 25, 2004 (besides going to Long Island). I won't tell about the other
things, but doesn't that sound pretty boring?...*sigh*... I still had lots
of fun when I went to Manhattan one Sunday, though. I'll tell about that.
On that day my family and I traveled to Manhattan, when we arrived, we
walked through this long avenue filled with all these shops which were
right on the road. Many people were walking up and down the roads shopping.
It was like a Flea Market, but way larger and longer. After that, we went
to the Sony Wonder Techonology Lab on 550 Madison Avenue, New York, NY
10022. This was the very fun part, the best part of the day. This place
educates visitors with facts about everything of techonology, television,
sound, etc. once you start exploring. Downstairs there is even games and
lots of other very fun things yo do. There is really too much to explain.
At the end, you get a certificate, circling all the activities you played.
Outside the lab, there is also a person-controlled robot named Bibi the
Wonderbot which would respond to your questions. I really recommend anyone
who is interested, to visit there. Here are 2 websites you can visit www.sonywondertechlab.com
any www.sony.com. We spent the rest of the time at the Pokemon Center and
then went home.
Amy 503 9 PS101Q
Forest Hills, NY USA - Sunday, July 25, 2004 at 21:32:46 (EDT)
I like neopets cards.
Andy C. 5 ps101
Forest Hills, NY USA - Sunday, July 25, 2004 at 20:49:23 (EDT)
HELLO Everyone, Check out this adventure website. You will read
about dragons and choose how the story goes. Write me here and tell me
what you think.... Enjoy, Mr. Stein .... Select the following, Then edit
copy, then paste it the address bar above... Press enter. When you get
ti the website click on "Begin"..... http://www.geocities.com/soho/exhibit/2925/craggen/begin.htm
Mr. Stein
USA - Thursday, July 22, 2004 at 18:32:39 (EDT)
MESSAGE TO: Aleks 8 How is camp? What are your favorite activities?
MESSAGE TO: Olivia 501: POLAND WOW!!! Is it different there? I have never
been there. Would I like it? What is there to do?
Mr. Stein
USA - Thursday, July 22, 2004 at 12:51:29 (EDT)
HI! I'm in summer camp at kew forest!I'm having a good time.How
are you?I'm still in New York.Any way have a good summer!!!
Aleks 8 N.Y. Forest Hills
USA - Wednesday, July 21, 2004 at 16:18:25 (EDT)
Hi Mr Stein im in poland how is it in new york? everything is fine
here. Soon vacation will end. See you later.
Olivia 501 P.S.101Q.
Grudziądz, Poland - Wednesday, July 21, 2004 at 10:36:32 (EDT)
YOU ARE A GOOD TEACHER.YOU ARE A NICE TEACHER.
NATALIE, 6, PS101
FOREST HILLS, NY USA - Sunday, July 18, 2004 at 17:53:11 (EDT)
Hi. I was searching on the web and I found your website. I'll visit
your website again bye.
Adam
USA - Friday, July 16, 2004 at 15:47:40 (EDT)
MESSAGE TO: Michael w. 9years 4-402 ps101Q - So far I like your
BEST DAY..... SO far you win a Prize... I would like other entries. See
you in September.
Mr. Stein
USA - Tuesday, July 13, 2004 at 15:55:22 (EDT)
Dear Mr.stain In the Bronx Zoo,There are lots of animals,They gave
us a map.The first animal that we saw was gorillas and there was a big
gorilla and a little gorilla that ate their breakfast. Then we rode the
tram bus.I said,"Can we take a break?" My dad said,"Yes we can. Then we
rode the cable car.I said,"Don't look down because it is high."Then the
camera battery went dead and my dad asked the zookeeper,"My battery is
dead can I change the battery without paying?" The zookeeper said,"Yes
you can." Then my stomach hurt,we went to the restaurant and I drank a
soda and I had a hamburger.My dad then looked for Tiger Mountain and he
just couldn't find it.We got lost looking for Tiger Mountain,we saw the
other animals bears,elephant and Tiger. Finally,my dad ask where is the
Tiger Mountain? And he said,"To go to straight,and we found the Tiger Mountain.
Then,we saw the snakes and the monkeys.The monkey was playing around. My
dad and I went to the butterfly house,there is thousand of butterflys and
we feed the animals.The rain came so hard and we went to the car.
Michael w. 9years 4-402 ps101Q
USA - Monday, July 12, 2004 at 22:58:31 (EDT)
MESSAGE TO:Maritza crespo 13, washton middle school Meriden, CT
USA, Hello from Mr. Stein. I am the webmaster of this site. How did you
find us? What educational activities do you like best. TO jhostin,602.
Chatting is dangerous. Please call Jabir. Ask a friend for his number.
Have a great summer. To Wataru. WOW you are in Japan... WHen school starts
we can have you locate the city in Japan on our world map. How is Japan
different? See you in September. I am now at Japan. I am living at my grandparents`
house. So far, I am at Nakasone Elementary School. Wataru, 9, 402 Yoshikawa,
Saitama Japan - Monday, July 12, 2004 at 06:41:04 (EDT)
Mr. Stein
USA - Monday, July 12, 2004 at 19:32:17 (EDT)
jabir I hope you get online to chat with you
jhostin,602
USA - Monday, July 12, 2004 at 18:33:05 (EDT)
I am now at Japan. I am living at my grandparents` house. So far,
I am at Nakasone Elementary School.
Wataru, 9, 402
Yoshikawa, Saitama Japan - Monday, July 12, 2004 at 06:41:04 (EDT)
hi my name is maritza
Maritza crespo 13, washton middle school
Meriden, CT USA - Monday, July 12, 2004 at 06:38:23 (EDT)
MESSAGE TO: Brian,10,602,ps101 Hey Brian, What is DR. I might want
to go there. Keep in touch. Mr. S.
Mr. Stein
USA - Sunday, July 11, 2004 at 19:41:33 (EDT)
hey mr stein, guess what, i just came back from dr!!! it was great.
that was the best vacation ever
Brian,10,602,ps101
ny, ny USA - Saturday, July 10, 2004 at 22:43:56 (EDT)
i saw you kiss ms. betty,mr. stein
tristan 6 k-013 ps101
forest hills, ny USA - Monday, July 05, 2004 at 18:21:06 (EDT)
Heyy Mr Stein!! it's me Jonette! i'm living in Milford, Connecticut
now...i miss every1!! c ya!
Jonette
Milford, CT USA - Monday, July 05, 2004 at 16:50:55 (EDT)
"BEST SUMMER DAY CONTEST" By Mr. Stein WIN A TYPING PROGRAM ***
BEST SO FAR---Jordan Knight 9, 403- What a Great Day! Write us from England!!!!
HELLO TO: Jasmine Blackwell, 10, 4-216, P.S.205--Thanks for your wonderful
comments!!!!
Mr. Stein
USA - Monday, July 05, 2004 at 07:41:03 (EDT)
I love your optical illusions they are so fun and challenging. You
are so clever, that I have to say that I didn't get all of them.
Jasmine Blackwell, 10, 4-216, P.S.205
Jamaica, N.Y. USA - Sunday, July 04, 2004 at 22:09:37 (EDT)
Hey 101 ! I am having a great summer. I saw fireworks yesterday.
Well I am selling my house for a lot of money. My parents are going to
give my brother, and my sister and I are going too get 10,000 each. I am
also going to england and stay at the buckinhaghn palace. I am going to
Italy for a wedding. I will try too write. Have good summer bye.
Jordan Knight 9 403 P.S.101 Q
Shelter Island, N.Y. USA - Sunday, July 04, 2004 at 13:36:34 (EDT)
Dear Mr.Stein,I miss the school so much.I am not doing anything
for one whole week.I am going to summer school next week.I will see you
next year!!
Colleen 8 next year 301 ps101
USA - Friday, July 02, 2004 at 13:32:28 (EDT)
"BEST SUMMER DAY CONTEST" By Mr. Stein WIN A TYPING PROGRAM ***
BEST SO FAR---Susan 10 402 P.S.101
Mr. Stein
USA - Wednesday, June 30, 2004 at 21:32:00 (EDT)
i see you kiss ms betty.
ko13ps
usa, ny USA - Wednesday, June 30, 2004 at 20:22:50 (EDT)
I am in my mom's office in Manhatten. My mom works as a techician
in the New York Blood Center. There is a custodian named Peter in the caffetaria.
Peter is a funny custodian. By the way, thanks for teaching me how to cheat
because now I can cheat on my mom's computer in her office. In the morning,
we stayed in the caffetaria and played with my brother's game boy advance
sp. At lunchtime, we went to eat pizza at a pizzastore. I wanted a peporoni
pizza, but when the pizza came, my brother wanted my peporoni pizza so
I had to eat his chicken/broccoli pizza. I was not happy. I wanted to cry
except I did not cry. Instead, I just sniffed up my tears up my nose. I
was not happy because I do not like chicken/broccoli pizza. By the way,
did I ever tell you that my brother always makes me sad.
Susan 10 402 P.S.101
Manhatten, NY USA - Wednesday, June 30, 2004 at 16:42:23 (EDT)
I am in my mom's office in Manhatten. My mom works as a techician
in the New York Blood Center. There is a custodian named Peter in the caffetaria.
Peter is a funny custodian. By the way, thanks for teaching me how to cheat
because now I can cheat on my mom's computer in her office. In the morning,
we stayed in the caffetaria and played with my brother's game boy advance
sp. At lunchtime, we went to eat pizza at a pizzastore. I wanted a peporoni
pizza, but when the pizza came, my brother wanted my peporoni pizza so
I had to eat his chicken/broccoli pizza. I was not happy. I wanted to cry
except I did not cry. Instead, I just sniffed up my tears up my nose. I
was not happy because I DO NOT LIKE CHICKEN/BROCCOLI PIZZA!
Susan 10 402 P.S.101
Manhatten, NY USA - Wednesday, June 30, 2004 at 16:40:50 (EDT)
MESSAGE FROM MR. STEIN TO: Adrienne 7 202 ps101 and Jessica b. 8
: Thanks for the messages from Illionois and Brooklyn. Enjoy the summer.
MR. STEIN
USA - Sunday, June 27, 2004 at 14:37:20 (EDT)
Dear Mr.Stein,I am in Illinois.It is really fun. Iam playing with
dogs! Love Adrienne
Adrienne 7 202 ps101
USA - Saturday, June 26, 2004 at 17:50:28 (EDT)
Hi, Mr. Stien .You cool? I'm in Brooklyn. See you later.
Jessica b. 8
USA - Saturday, June 26, 2004 at 13:28:53 (EDT)
Mr.Stein, may you please paste my animation, from GIF movie gear,
on the emaginatorium website. You saved it in "Danscrap." The name is "umbrella4107."
Amy 9 401
forest hills, NY USA - Friday, June 25, 2004 at 22:54:28 (EDT)
I"M GONNA MISS EVERY1!!!! ESPECIALLY MY FRIENDS, JABIR, N THE TEACHERS..GOOD
LUCK EVERY1 KEEP IN TOUCH WITH THIS GUESTBOOK!
Jonette
USA - Friday, June 25, 2004 at 19:16:43 (EDT)
Lauren- I think the optical illusions were great. Hannah- I think
the optical illusions were really facinating. I it was the most amazing
thing ever(not reallythere are other amazing things).
Hannah&Lauren
New York City, NY USA - Friday, June 25, 2004 at 16:02:36 (EDT)
I sow you kis on the lips.
Toma 6 ko13
USA - Friday, June 25, 2004 at 09:30:24 (EDT)
I like to play on the comuputer.
Emma 6 k 01 3
USA - Friday, June 25, 2004 at 09:30:05 (EDT)
PLAY WITH MY CASIZIN. WENE I GO TO POLIND I WILE CLIM A CASOL.
ANDREA . MARK
N.Y, USA - Friday, June 25, 2004 at 09:29:03 (EDT)
Mr.Stein is a computer geius.
Michael N 5 k-013
USA - Friday, June 25, 2004 at 09:25:06 (EDT)
WAR ARE YOU GOWIG MR.LOVER MAN.
CAROLIE 6 K-013
USA - Friday, June 25, 2004 at 09:24:17 (EDT)
i see you kissing ms btty.
sebastian
usa, ny USA - Friday, June 25, 2004 at 09:20:11 (EDT)
hello class
mr moss
USA - Friday, June 25, 2004 at 09:05:39 (EDT)
dear mr.stine I miSS you
zaheer 6 101
ny, usa USA - Friday, June 25, 2004 at 08:53:09 (EDT)
Class 2-204, The word of the day is kvell. I can use it in a sentence.
When my students work hard and do well in school, I kvell (meaning I'm
proud!)
Mr. Gelber 204 101
USA - Thursday, June 24, 2004 at 20:26:30 (EDT)
mr.stian here is spanish olla kakka mama dows uno carrne chow. have
a good vacaition. bye.
Daniel 6/7 ps101 102
USA - Thursday, June 24, 2004 at 19:29:03 (EDT)
Dear Mr.Gelber, The word of the day is kvell.I can use it in a sentence.He
is very kvell.
Colleen 8 204 ps101
USA - Thursday, June 24, 2004 at 14:29:06 (EDT)
Dear Mr.Gelber, The word of the day is kvel. He is very kvel.
Claudia,7,204,PS101Q
USA - Thursday, June 24, 2004 at 14:28:55 (EDT)
With the money machine the coins fall into the right slot because
thier are areas that fit the coin so they go in.
Josh Solomon
N.Y.C., NY USA - Thursday, June 24, 2004 at 13:50:52 (EDT)
i like yor kompyootrs
sam 5 k014
USA - Thursday, June 24, 2004 at 10:23:05 (EDT)
To My Students of Class 201. Happy Summer. Write me here.
Mrs. Klein
USA - Thursday, June 24, 2004 at 09:51:02 (EDT)
The word of the day is kvell.I can use it in a sentence. He was
kvell.
Samantha 7 204 101
USA - Thursday, June 24, 2004 at 08:55:03 (EDT)
HAPPY SUMMER MR.GELBER !!!
Samantha , 7 , 204 , 101
USA - Thursday, June 24, 2004 at 08:47:35 (EDT)
Class 2-204 Claudia gets 20 points and Colleen gets 40 points. This
was my best year of teaching. The tears of happiness are dribbling down
my cheek onto the computer...:) Class 2-204 is the best!!
Mr. Gelber 204 101
USA - Wednesday, June 23, 2004 at 21:07:21 (EDT)
Dear Mr.Gelber, The word of the day is florescence. I read a book
with a florescence.
Claudia,7,204,PS101
USA - Wednesday, June 23, 2004 at 19:18:42 (EDT)
Dear Mr.Gelber, Even through I wrote to you,I am really going to
miss you.You did a great job teaching.I never had a better teacher than
you.You really are nice.At first,I thought second grade teachers are mean
and strict.I thought you were strict!I am really sorry.Mrs.Miller was nice
too.I miss her very much.I hope you had a great year like I did.Thank you
so much!
Colleen 8 204 ps101q
USA - Wednesday, June 23, 2004 at 16:21:26 (EDT)
Dear Mr.Gelber, The word of the day is florescence.I can use it
in a sentence.I found books about florescence art.
Colleen 8 204 ps101
USA - Wednesday, June 23, 2004 at 16:13:37 (EDT)
DearMr.Gelber, You are the best teacher I ever had.I hope you have
fun.I will miss you so much.Maybe we can see each other some day.
Naomi 7 204 ps101
USA - Wednesday, June 23, 2004 at 10:01:52 (EDT)
Dear Mr.Gelber, You are the greatest teacher in the whole wide world.I
am sorry we have to leave to third grade.I am sorry we have to leave you.
Elijah 8 2-204 P.S.101
Forest Hills, NY USA - Wednesday, June 23, 2004 at 09:48:43 (EDT)
Dear Mr.Gelber, You are the greatest teacher in the whole wide world.I
am sorry we have to leave to third grade.I am sorrywe have to leave you.
Elijah 8 2-204 P.S.101
Forest Hills, NY USA - Wednesday, June 23, 2004 at 09:48:23 (EDT)
Dear Mr.Gelber, I will miss you in the summer.I hope you have a
great vacation.
Sakura,7,204,P.S.101
Forest Hills, NY USA - Wednesday, June 23, 2004 at 09:37:53 (EDT)
Dear Mr.Gelber, Thanks for all the great things you did for us.You
are the greatest teacher.We had a great school year.Have a great summer
vacation.
Omri 7 204 P.S.101
USA - Wednesday, June 23, 2004 at 09:21:15 (EDT)
DEAR Mr.GELBER The school year is ending soon.I had a great year.I
hope you have a great summer vacation.
Matthew 7 204 ps101
USA - Wednesday, June 23, 2004 at 09:08:58 (EDT)
Dear Mr Gelber, Thanks for teaching us this year! You've done a
great job! You are the greatest, funniest, smartest 2nd grade teacher ever!
I hope you could be a 3rd grade teacher too. This good class are gonna
miss you. Bye.
Alicia 7 2-204 P.S101Q
USA - Wednesday, June 23, 2004 at 08:50:10 (EDT)
Sensational! 20 points for Sakura's table and 40 points for Colleen's
Table. Igor's table gets 20 points also. Class 2-204 is still the best
2nd grade class on the 2nd floor! (Even if they are the only 2nd grade
class on the 2nd floor :) )
Mr. Gelber 204 101
USA - Tuesday, June 22, 2004 at 21:12:11 (EDT)
Dear Mr.Gelber, I am going to miss you in summer vacation.I am happy
you been a great teacher to everyone.I hope you would be happy with your
next year students.
Colleen 8 204 ps101
USA - Tuesday, June 22, 2004 at 20:03:26 (EDT)
DearMr.Gelber , Thank you for being my teacher. You have been a
nice teacher. I will miss you in the summer vacation.
Sakura,7,204,P.S.101
Forest Hills, NY USA - Tuesday, June 22, 2004 at 19:56:22 (EDT)
Mr.Gelber!I got 100.97 seconds on dodge square.
Colleen 8 204 ps101
USA - Tuesday, June 22, 2004 at 16:16:22 (EDT)
Mr.Gelber,the word of the day is peremptory.I can use it in a sentence.Obey
a police officer's perempory!
Colleen 8 204 ps101
USA - Tuesday, June 22, 2004 at 16:12:09 (EDT)
Dear Class 2-204, I am moved to tears. I am glad you had a super
year. Great Dodge square score Igor.
Mr. Gelber 204 101
USA - Tuesday, June 22, 2004 at 15:07:32 (EDT)
Dear mr.Gelber, on dodge square i got 92.44 seconds.
igor 8 204 p.s.101
USA - Tuesday, June 22, 2004 at 15:05:30 (EDT)
Dear Mr.Gelber, I had a great year.I liked all the trips. You are
a great teacher.I wish you could be my third grade teacher.I will miss
you.
igor 8 204 ps101
USA - Tuesday, June 22, 2004 at 14:46:21 (EDT)
Dear Mr.Gelber,I will miss you for the vacation.You are the best
teacher in the whole wideworld.your student, Kevin
Kevin 204 8
USA - Tuesday, June 22, 2004 at 14:13:09 (EDT)
Dear mr. Gelber, I had a great year.Thank you for a great year.
Alexander 7 204 101
USA - Tuesday, June 22, 2004 at 13:56:12 (EDT)
Dear Mr.Gelber you have bin a wonderful teacher and the greatist
teacher.I hope you have a great vacation.
chanel 8 204 P.S.101
Forest Hills, NY USA - Tuesday, June 22, 2004 at 13:47:27 (EDT)
Dear Mr.Gelber I feel heart broken. I will miss you very much. It
feels bad that I am going!
Eric 8 2-204 ps101
USA - Tuesday, June 22, 2004 at 12:29:23 (EDT)
Dear mr. G i hope you miss me i miss you love kayla
Kayla 7 204 ps101
USA - Tuesday, June 22, 2004 at 11:10:03 (EDT)
Dear mr. G i hope you miss me i miss you love kayla
Kayla 7 204 ps101
USA - Tuesday, June 22, 2004 at 11:09:55 (EDT)
Dear Mr.Gelber, I will miss you .I hope you will have a nice vacation.
ryht ewou h
Deniz 7 204 ps101
USA - Tuesday, June 22, 2004 at 10:56:14 (EDT)
Dear Mr.Gelber, I will miss you .I hope you will have a nice vacation.
ryht ewou h
Deniz 7 204 ps101
USA - Tuesday, June 22, 2004 at 10:56:07 (EDT)
Dear Mr.Gelber, I will miss you .I hope you will have a nice vacation.
ryht ewou h
Deniz 7 204 ps101
USA - Tuesday, June 22, 2004 at 10:55:02 (EDT)
ryht ewou h
Deniz 7 204
USA - Tuesday, June 22, 2004 at 10:50:38 (EDT)
Hi, Mr. stein I broke the record of square dodge it was 127.21 seconds
and if you don't belive me ask Xavier and Jhostin.
Jabir,12,602 P.S101
USA - Tuesday, June 22, 2004 at 09:50:05 (EDT)
Dear Mr.Gelber, The word of the day is peremptory.I will peremptory
you to my club.
Claudia,7,204,PS101Q
USA - Tuesday, June 22, 2004 at 09:44:40 (EDT)
Dear Mr.Gelber, Good-Bye. You were the best second grade teacher
ever. Do you have to stay in second grade?
Claudia,7,204,PS101Q
USA - Tuesday, June 22, 2004 at 09:37:27 (EDT)
Dear Mr.Gelber, The word of the day is peremptory.I can use it in
a sentence.Obey your parents peremptory when they say do not stand on the
road.
Igor 8 2-204 P.S.101
USA - Tuesday, June 22, 2004 at 09:27:47 (EDT)
bye mr. gelber if u wanna be a 3rd grade teacher you can. have fun
with your other second grade class bye bye
justin 7 ps101
USA - Tuesday, June 22, 2004 at 08:42:28 (EDT)
ihi rmay einstay i may avinghay a reatgay imetay ithway ymay mousincay
amiejay .yebay rmay einstay.
justin 7 ps101
USA - Tuesday, June 22, 2004 at 08:40:20 (EDT)
Dear Colleen, Thank you. I will miss ALL the students in class 2-204,
especially the hard-working,good-behaved students :) Have a great summer!!!!
Mr. Gelber 204 101
USA - Monday, June 21, 2004 at 21:42:33 (EDT)
Dear Ms. Newton, I Like Computer
Johnny, 12, 1-207, ps30
USA - Monday, June 21, 2004 at 18:56:59 (EDT)
Dear Mr.Gelber, I am going to miss you very much.You been a great
teacher.Besides,I wanted to you the word of the day.The word of the day
is roseate.I can use it in a sentence. Colleen were making some fairly
roseate.
Colleen 8 204 ps101
USA - Monday, June 21, 2004 at 15:30:49 (EDT)
I graduated on the 18
Aaron 601
USA - Monday, June 21, 2004 at 14:15:31 (EDT)
I graduated on the 18
Aaron 601
USA - Monday, June 21, 2004 at 14:15:24 (EDT)
Dear Mr.Gelber, I know you live in a log cabin. He was a Native
America. You got lost in the Alantic ocean.
Eric 8 2-204 ps101
USA - Monday, June 21, 2004 at 10:30:45 (EDT)
Dear Mr.Gelber I found the word of the day.The word of the day is
roseate.I can use it in a sentence.I like the color roseate
Eric 8 2-204 ps101
USA - Monday, June 21, 2004 at 10:19:18 (EDT)
Did anyone do anything great this weekend with DAD for Father's
Day?
Mr. Stein
USA - Sunday, June 20, 2004 at 18:37:08 (EDT)
Mr.Gelber,the word of the day is mettle.The rough trail is a challenge
enoughto test the mettle.
Colleen 8 204 ps101q
USA - Sunday, June 20, 2004 at 09:24:07 (EDT)
Hi Everyone, Have a GREAT Summer!!
Mr. Stein
USA - Saturday, June 19, 2004 at 22:27:18 (EDT)
Dear Mr.Gelber, The word of the day is caitiff.He is caitiff.
Colleen 8 204 ps101
USA - Saturday, June 19, 2004 at 14:40:40 (EDT)
MESSAGE GFROM MR. STEIN TO: Michael K-013- What colors are your
3D glasses? TO: MIchelle Rodgers: Thanks for the kind words!! Have a Great
Summer
Mr. Stein
USA - Saturday, June 19, 2004 at 14:11:08 (EDT)
hi mr. stein i have 3d glasses from shrek 3d
michael v. k-013
USA - Saturday, June 19, 2004 at 09:23:17 (EDT)
I am Michelle Rodgers aunt and my family and I came by and visited
your class. We really enjoyed it and I love your website. Thank you for
making us feel welcome
Claudia Owens
Austin, TX USA - Friday, June 18, 2004 at 18:21:53 (EDT)
Dear Mr.Gelber, The word of the day is regale.I can use it in a
sentence.He is very regale.
Colleen 8 204 ps101q
USA - Friday, June 18, 2004 at 15:39:05 (EDT)
MESSAGE FROM MR. STEIN: CAN YOU UNDERSTAND THIS MESSAGE IN PIG LATIN.....ELLTAY
EMAY ATWHAY OUYAY ILLWAY ODAY ISTHAY UMMERSAY...... I WILL MISS YOU ALL!!!
Mr. Stein
USA - Friday, June 18, 2004 at 08:57:16 (EDT)
dear mr.stein, I'm going to miss you .you are my best friend!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
maria 8 202
ny USA - Thursday, June 17, 2004 at 23:14:09 (EDT)
Mr.Stein when I saw the 3D Mars it was so cool.
kathy 5 k-013
USA - Thursday, June 17, 2004 at 20:49:48 (EDT)
Claudia, Colleen and class 2-204, Keep up the good work! Try Dodge
Squares. Follow the directions. Print the best score and earn 25 bonus
points for your table. Let me know how much fun you had.
Mr. Gelber 204 101
USA - Thursday, June 17, 2004 at 20:25:49 (EDT)
Dear Mr.Gelber, The word of the day is mansuetude. He is very mansuetude.
Claudia,7,204,PS101Q
USA - Thursday, June 17, 2004 at 19:53:58 (EDT)
Dear Mr.Gelber, The word of the day is mansuetude.I can use it in
a sentence.The kitten may give off an air mansuetude.
Colleen 8 204 ps101q
USA - Thursday, June 17, 2004 at 15:04:16 (EDT)
ilikepowerrangerstoyandmymomisbuypowerrangers
godfrey6102ps101
USA - Thursday, June 17, 2004 at 12:58:25 (EDT)
HELLO TO MR. GELBER AND CLASS 204..... YOU ARE DOING GREAT!!! YOU
MAKE ME PROUD!
Mr. Stein
USA - Thursday, June 17, 2004 at 06:30:20 (EDT)
The word of the day is erstwhile.I can use it in a sentance. The
park erstwhile was a garbage dump.
Samantha , 7 , 204 , 101,
Forest Hill, NY USA - Wednesday, June 16, 2004 at 20:08:00 (EDT)
Dear Mr.Gelber, The word of the day is estwhile.There is a park
that estwhile had been trash.
Colleen 8 204 ps101
USA - Wednesday, June 16, 2004 at 15:54:04 (EDT)
hi mr. gelber. the word of the day is erstwhile.he moved into a
new building which erstwhile was a park
PLEASE WRITE YOUR NAME 7 204 ps101
USA - Wednesday, June 16, 2004 at 07:09:14 (EDT)
Hooray Sakura and Colleen on the Word of the Day. Sakura you recited
the months of the year beautifully today in class. Hope your table enjoyed
the pretzels (and the bonus points).
Mr. Gelber 204 101
USA - Tuesday, June 15, 2004 at 19:15:19 (EDT)
DearMr.Gelber, The word of the day is slipshod.I can use it in a
sentence. (I never have slipshod shod shoes.)
sakura,7,204
USA - Tuesday, June 15, 2004 at 18:03:51 (EDT)
Dear Mr.Gelber, The word of the day is slipshod.Mr.Gelber found
alot of slipshod on her homework.
Colleen 8 204 ps101q
USA - Tuesday, June 15, 2004 at 16:34:13 (EDT)
Dear Ms.Fiden, I am having so much fun in Canada! From, Anna
Anna 7 202 ps101
USA - Tuesday, June 15, 2004 at 14:04:25 (EDT)
Dear Ms.Fiden, I am having so much fun in Canada! From, Anna
Anna 7 202 ps101
USA - Tuesday, June 15, 2004 at 14:04:22 (EDT)
Good job Samantha, Claudia, Colleen and Sakura. You have earned
20 points each for your table. I'm sp happy :) Colleen, glad you can now
print switch zoo. I'll give your table 20 points and a cookie (they are
half chocolate and half vanilla and they are very good. I only ate the
broken cookies. So big deal there were 5 or 6 broken cookies in the jar....)
Sakura, repeat the poem in class correctly and earn 20 points for your
table. Okay everyone in table 2 can ALSO get 2 free little pretzels :)
Mr. Gelber 204 101
USA - Monday, June 14, 2004 at 22:11:43 (EDT)
Dear Mr.Gelber, The word of the day is emblazon. Today we are going
to have a emblazon at the park.
Claudia,7,204,PS101Q
USA - Monday, June 14, 2004 at 18:22:23 (EDT)
i love mr. stein !
isabella 5 k012
USA - Monday, June 14, 2004 at 17:29:43 (EDT)
the magic money machine has different hole on each colunm so the
coins can go in to the right colunm so that is why the coins right spot.
i gess so ?
isabella 5 k012
USA - Monday, June 14, 2004 at 17:27:44 (EDT)
Dear Mr.Gelber, I finally did the switchzoo!I got a new printer.I
will bring it in tomorrow.
Colleen 8 204 ps101q
USA - Monday, June 14, 2004 at 14:40:33 (EDT)
Dear Mr.Gelber, The word of the day is emblazon.The printer is very
emblazon.
Colleen 8 204 ps101q
USA - Monday, June 14, 2004 at 14:20:33 (EDT)
Dear Mr.Gelber, The word of the day is emblazon.
sakura,7,204
USA - Monday, June 14, 2004 at 13:25:10 (EDT)
30 days has september april june and november all the rest have
31 exept february which has 28 or 29 days in a laep year.
sakura,7,204,ps101
forest hills, USA - Monday, June 14, 2004 at 13:14:55 (EDT)
The word of the day is cregulus.I can use it in a sentence. She
is cregulus.
Samantha , 7 ,204 , 101
Forest Hills, NY USA - Sunday, June 13, 2004 at 21:14:12 (EDT)
Dear Mrs.Fiden, My cousin says Hi!
Anna 7 202 ps101
USA - Sunday, June 13, 2004 at 18:18:45 (EDT)
Dear mr.stein, I am in Canada with my cousin. I am having so much
fun! From, Anna Maria
Anna 7 202 ps101
USA - Sunday, June 13, 2004 at 18:00:53 (EDT)
Dear Mr.stein, I think I know the awnser to the riddle of the missing
dollar.I think there isn't one.
Harrison,7,101
USA - Sunday, June 13, 2004 at 17:02:50 (EDT)
Class 2-204 Boys and Girls, I did a search and I found out one famous
left-handed person. Would you believe that Bart Simpson of the Simpsons
is a left?? Can you find out any other left- handed people?
Mr. Gelber 204 101
USA - Sunday, June 13, 2004 at 12:01:43 (EDT)
Dear Mr.Gelber, The word of the day is credulous.She is very credulous.
Colleen 8 204 ps101
USA - Sunday, June 13, 2004 at 10:16:43 (EDT)
Dear Mr.Gelber, The word of the day is asperity. Matt has a lot
of asperity.
Claudia,7,204,PS101
USA - Saturday, June 12, 2004 at 18:33:22 (EDT)
Dear Mr.Gelber, The word of the day is asperity.I can use it in
a sentence.When asked to make a picture,Ann moaned and said with asperity,"I
am not a good artist."
Colleen 8 204 ps101q
USA - Saturday, June 12, 2004 at 17:32:15 (EDT)
Hey ppl!!...FIELD DAY WAS THE BEST TRIP I EVER HAD!! I GET 2 PLAY
BASEBALL....but i bruised myself a little, it still hurts. I HAD SO MUCH
FUN 2DAY!
Jonette
USA - Friday, June 11, 2004 at 17:33:58 (EDT)
Dear Mr.Gelber, The word of the day is polyonymous.A polyonymous
criminal is bad.
Colleen 8 204 ps101
USA - Friday, June 11, 2004 at 15:05:25 (EDT)
Here are our scores: Manar:27.24, 30.65, 24.33, 32.57,
Manar Class: 402
USA - Friday, June 11, 2004 at 10:36:08 (EDT)
This was my highest score Nancy 34.55
Nancy
Forest Hills, NY USA - Friday, June 11, 2004 at 10:34:38 (EDT)
Here are my scores Taimur 42.62 seconds
Taimur 10 402 ps101q
Forest Hills, NY USA - Friday, June 11, 2004 at 10:33:13 (EDT)
Here are my scores: Lyle 2.08, 4.09, 9.38, 5.33, 15.27, 15.71, 15.62,
17.53, 18.13, 60.23, 24.99, 26.58, 21.42, 30.52
Lyle 9 402 P.S.101
Forest Hills, NY USA - Friday, June 11, 2004 at 10:30:33 (EDT)
Here are our scores: Emily H. : 23.12 Frankie C.: 31.91
Emily H. Frankie C.
USA - Friday, June 11, 2004 at 10:24:07 (EDT)
our score 1.65, 900001, 66, 2277, 2.75, 4456, 49, 1.65, 100000007,
1.26, 100000000000000000000888, 43, 525,
krishen andmichael v . toma.
ko13., USA - Friday, June 11, 2004 at 09:48:10 (EDT)
my scors1.34
kevin
USA - Friday, June 11, 2004 at 09:30:29 (EDT)
my score was 45.89
julia b. 5 k013
USA - Friday, June 11, 2004 at 09:29:53 (EDT)
my score was 1.54,
andrea 5 k013
USA - Friday, June 11, 2004 at 09:26:09 (EDT)
Dear Mr.Gelber, Incipient stomachache.
Claudia,7,204,PS101
USA - Thursday, June 10, 2004 at 18:58:11 (EDT)
None.
Gina Newman, 12, 603, P.S.101
Forest Hills, NY USA - Thursday, June 10, 2004 at 16:56:36 (EDT)
Horray,it's Byokklen Queens day.No school.
Colleen 8 204 ps101
USA - Thursday, June 10, 2004 at 13:20:49 (EDT)
The word of the day is incipient.Incipient jealousy is not very
good.
Colleen 8 204 ps101
USA - Thursday, June 10, 2004 at 09:47:55 (EDT)
Mr.Gelber,your students are not sleeping.Some of them don't have
computers.Some of them forgets to do it.I just want to do it because I
like typing on the computers.
Colleen 8 204 ps101
USA - Thursday, June 10, 2004 at 09:44:11 (EDT)
MESSAGE FROM MR. STEIN TO CLASS 204: Mr. Gelber is left handed.
Do you know any otherpeople who are left handed? Which is more popular:
left handed people or right handed people?
Mr. Stein
USA - Thursday, June 10, 2004 at 08:40:35 (EDT)
Claudia and Colleen are our star students earning 20 points each
for table 1. Where are the other students in my class? Are they sleeping?????
Mr. Gelber 204 101
USA - Wednesday, June 09, 2004 at 20:35:47 (EDT)
Claudia and Colleen are our star students earning 20 points each
for table 1. Where are the other students in my class? Are they sleeping?????
Mr. Gelber 204 101
USA - Wednesday, June 09, 2004 at 20:34:34 (EDT)
Dear Mr.Gelber, The word of day is proplquity. Champ would be proplquity
at home.
Claudia,7,204,PS101
USA - Wednesday, June 09, 2004 at 18:20:55 (EDT)
Your real name is Dan.
Melissa 6 102
USA - Wednesday, June 09, 2004 at 18:10:51 (EDT)
i sended you a message go check your inbox
Andrew
USA - Wednesday, June 09, 2004 at 16:36:33 (EDT)
Mr.Gelber,I couldn't do the zookeeper because I don't have a printer.The
word of the day is propinquity.If it weren't for the computer office's
propinquity, my dad wouldn't be a computer worker.
Colleen 8 204 ps101
USA - Wednesday, June 09, 2004 at 16:04:01 (EDT)
Claudia and Colleen, Good job!!! Actually Mr. Gelber is a southpaw.
I use my left hand to write with. All great people are left handed!!Well,
you already knew that your teacher is gifted and talented :) Thanks for
telling me about Alexander. I was surprised that so many students started
to cry when I wanted to re-arrange seats in the class yesterday. There
were so many tears that I thought I was at a Wedding!!!!!!!!!!!!!!!!!!!!!!!!!
:) I learned my lesson. We'll leave everyone where they are. well maybe
I'll move one or two students.... :)
Mr. Gelber 204 101
USA - Wednesday, June 09, 2004 at 06:52:53 (EDT)
Claudia and Colleen, Good job!!! Actually Mr. Gelber is a southpaw.
I use my left hand to write with. All great people are left handed!!Well,
you already knew that your teacher is gifted and talented :) Thanks for
telling me about Alexander. I was surprised that so many students started
to cry when I wanted to re-arrange seats in the class yesterday. There
were so many tears that I thought I was at a Wedding!!!!!!!!!!!!!!!!!!!!!!!!!
:) I learned my lesson. We'll leave everyone where they are. well maybe
I'll move one or two students.... :)
Mr. elber 204 101
USA - Wednesday, June 09, 2004 at 06:52:24 (EDT)
Dear Mr.Gelber, The wor of the day is southpaw. Jake is a southpaw
writer.
Claudia,7,204,PS101
USA - Tuesday, June 08, 2004 at 19:54:50 (EDT)
i like my dad andmom
andy 6 k-012 ps101
USA - Tuesday, June 08, 2004 at 18:48:21 (EDT)
Dear Mr.Gelber, I read your autobiography again.I'm glad you moved
me to table one.Not only are they winning, it's because Alexander keeps
on bothering me when I write.Your family lived in Spain for hundreds of
year.Your family also lived in Israel.You were born in Flushing.
Colleen 8 204 ps101
USA - Tuesday, June 08, 2004 at 13:57:06 (EDT)
Dear Mr.Gelber, The word of the day is southpaw.Elijah is the best
southpaw in the class.
Colleen 8 204 ps101
USA - Tuesday, June 08, 2004 at 13:43:32 (EDT)
Dear Mr.Gelber, Mr.Gelber the word of the day is echelon. I now
how to say the word of the day in a sentence. I have to do a echelon for
math.
Claudia,7,204,PS101
USA - Monday, June 07, 2004 at 21:04:33 (EDT)
Dear Mr.Gelber, Your family stayed in Spain for hundreds of years.
You are a native of Flushing. Your family left Spain without a compass.
Claudia,7,204,PS101
USA - Monday, June 07, 2004 at 20:53:13 (EDT)
The word of the day is echelon.I can use it in a sentance. She is
in a higher echelon in gymnastics.
Samantha ,7 , 204, 101
Forest Hills, N.Y. USA - Monday, June 07, 2004 at 20:04:29 (EDT)
??????????????????????????????????????????????????????????. the
word of the day is echelon.I won the game and move to the upper echelon.
justin 7 204 ps101
USA - Monday, June 07, 2004 at 19:43:42 (EDT)
Mr.Gelber,the mystery person was me.I was in a hurry,so I wrote?
? ? ?.
Colleen 8 204 ps101
USA - Sunday, June 06, 2004 at 18:26:34 (EDT)
After monday is my birthday.
kathy 5 k-013
USA - Sunday, June 06, 2004 at 17:27:27 (EDT)
soon it will be my birthday.
kathy 5 k-013
USA - Sunday, June 06, 2004 at 17:11:31 (EDT)
becase the mony mene
kathy
USA - Sunday, June 06, 2004 at 17:09:38 (EDT)
I like you
david 6
ko14, USA - Sunday, June 06, 2004 at 15:22:57 (EDT)
I like you
david 6
ko14, USA - Sunday, June 06, 2004 at 15:21:27 (EDT)
I like ps101
Toma 5 k- 013 ps101
USA - Sunday, June 06, 2004 at 15:14:58 (EDT)
MR. STEIN MESSAGE TO ANDREW: I know 212 people named Anrdrew. I
will help with composer but I know noit who you are.... Bye.
MR. STEIN
USA - Sunday, June 06, 2004 at 13:52:37 (EDT)
Hi Mr.Gelber,I know it's the weekand but I just wanted to tell you
the word of the day.The word of the day is pusillanimous.I can use it in
a sentence.I am not pusillanimous.
????
USA - Sunday, June 06, 2004 at 12:42:26 (EDT)
my e-mail*
Andrew
USA - Sunday, June 06, 2004 at 09:53:29 (EDT)
Mr.stien how do you publish a web page on netscape composer i keep
on messing up if you know how please send me a e-mail if you remember mine.
Andrew
USA - Sunday, June 06, 2004 at 09:52:58 (EDT)
power rangers oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo
sebastian, 6, k-013 , ps101
ny, USA - Sunday, June 06, 2004 at 08:41:50 (EDT)
hi mr. gelber the word of the day is braggadocio.i am braggadocio.
justin 7 204 ps101
USA - Friday, June 04, 2004 at 23:21:34 (EDT)
hi mr gelber its me justin!i read your autography .you were born
in flushing!if gelbers came to america we would of be celebrating gelbers
day.Almost 4 ships came to america.
?????? 7 204 ps101
USA - Friday, June 04, 2004 at 23:17:37 (EDT)
hi mr gelber its me justin!i read your autography .you were born
in flushing!if gelbers came to america we would of be celebrating gelbers
day.Almost 4 ships came to america.
?????? 7 204 ps101
USA - Friday, June 04, 2004 at 23:15:10 (EDT)
I figered how the magic money machine workes. It is because of the
size of the coins
Areta, 5, k-011, 101
USA - Friday, June 04, 2004 at 19:45:52 (EDT)
HEY PEOPLE.
Shunella 10 502 P.S.101Q
Forest Hills, NY USA - Friday, June 04, 2004 at 15:19:19 (EDT)
Just used your composite animals with my bilingual class. they loved
it !!! Hope all is well with you. judy
judy becker(01y-NYIT)
NY, NY USA - Friday, June 04, 2004 at 14:15:44 (EDT)
DearMr.Gelber, I found the word of the day.The word of the day is
braggadocio.I can use it in a sentence.I won a game and I cept braggadocio.
omri 7 204 ps101q
USA - Friday, June 04, 2004 at 13:41:33 (EDT)
Mr.Gelber I found the word of the day.the word of the day is braggadocio.I
can use it in a sentence.(I am not braggadocio.)
Eric 8 204 ps11
USA - Friday, June 04, 2004 at 13:40:17 (EDT)
Dear Mr.Gelber I know the word of the day it is braggadocio.I can
uses it in a sentence.My brother cept on braggadocio when he won the starring
contest.
Elijah 8 2-204 P.S.101
USA - Friday, June 04, 2004 at 13:26:11 (EDT)
Mr. Gelber, The word of the day is Braggadoci.. I can use it in
a sentence. Mr. Gelber do not like students who are braggadoci.
Alexander 7 204 p.s. 101
USA - Friday, June 04, 2004 at 12:14:22 (EDT)
The word of the day is defalcation. I can use it in a sentence.
He did a defalcation.
Samantha, 7, 204, PS101
Forest Hills, NY USA - Thursday, June 03, 2004 at 20:46:24 (EDT)
Dear Mr.Gelber, The word of the day is defalcation. Tom made a defalcation
of cookies.
Claudia,7,204
USA - Thursday, June 03, 2004 at 18:53:14 (EDT)
I got 52.195 sec. On the Doodle Square. Hope I win!!!
Olivia G. 10 Class 401 P.S.101Q.
Forest Hills, N.Y. USA - Thursday, June 03, 2004 at 17:56:50 (EDT)
Mr.Gelber,the word of the day is defalcation.I can use it in a sentence.I
do not defalcation.
Colleen 8 204 ps101
USA - Thursday, June 03, 2004 at 16:44:22 (EDT)
OMG!!! i heard that Alex Rodriguez and his wife is pregnant!! THEY"RE
HAVING A BABY!! omg!! i just heard yesturday in the new york post.
Jonette
USA - Thursday, June 03, 2004 at 16:19:03 (EDT)
I am going to Russia in summer.My whole family born there but I
was not born in Russia.So I do not like Russia very much.But my aunt is
going to be MARREID there.Ew,Ew,Ew,Ew.
Daniel Z. 6 102 P.S.101
New York City, N.Y USA - Thursday, June 03, 2004 at 13:01:43 (EDT)
DearMr.Gelber, I can use the word of the day in a sentence.(I do
not deflacation.)
sakura ,7,204,ps101
NY, USA - Thursday, June 03, 2004 at 12:29:47 (EDT)
DearMr.Gelber, I can use the word of the day in a sentence.(I do
not deflacation.)
sakura ,7,204,ps101
NY, USA - Thursday, June 03, 2004 at 12:29:47 (EDT)
Dear Mr.Gelber, I Found the word of the day is deflacation .Let
me tell a sentence with defalacatoin . she defalacationed the money.
Deniz 7 204 PS101Q
USA - Thursday, June 03, 2004 at 12:26:30 (EDT)
Dear Mr.Gelber, The word of the day is defalcation.I can use it
in a sentence
Deniz 7 204 ps101Q
USA - Thursday, June 03, 2004 at 11:15:28 (EDT)
DearMr.Gelber, The word of the day is defalcation.I can use it in
a sentence.
sakura ,7,204,ps101
USA - Thursday, June 03, 2004 at 11:06:51 (EDT)
DearMr.Gelber, The word of the day is defalcation.I can use it in
a sentence.
sakura ,7,204,ps101
USA - Thursday, June 03, 2004 at 11:06:49 (EDT)
Mr.Gelber I found the word of day.The word is defalcation.I can
use it in a sentene.I can defalcation.
Andrew 8 2-204 ps101
USA - Thursday, June 03, 2004 at 11:02:47 (EDT)
Chanel, You did a great job in class looking up the word of the
day and finding 3 facts about my life. :)
Mr. Gelber 204 101
USA - Wednesday, June 02, 2004 at 22:23:57 (EDT)
Sakura, Very Good. Abe Lincoln was born in a log cabin. I was born
in Flushing Hospital but grew up in a co-op. That's short for cooperative
not coop as in chicken coop :) My ancestors lived in Spain for hundreds
of years. That's why I can speak Spanish, sort of, -- mi clase es su clase!
or how about -- mi importante maestro de escuela P.S. 101
Mr. Gelber 204 101
USA - Wednesday, June 02, 2004 at 22:18:16 (EDT)
Colleen, Yes. I hope tommorrow is an auspicious day too. I want
to encourage the students to use the computer at home like you did. There
are only 2 computers in the classroom. Every one can't possibly use it.
Several students used the computer today. More students will use the computer
tommorrow. I have already picked a student from table 4 tommorrow. The
printer still does not work so we can't print any information.(hint, hint,
Mr. Stein :)
Mr. Gelber 204 101
USA - Wednesday, June 02, 2004 at 22:04:18 (EDT)
To the mystery student in my class who forgot to write his name,
I can't give you 20 points if I don't know which table earned it.
Mr. Gelber 204 101
USA - Wednesday, June 02, 2004 at 21:56:45 (EDT)
Dear Mr.Gelber, The word of the day is auspicious. It is an auspicious
day.
7 204 P.S.101Queens
USA - Wednesday, June 02, 2004 at 21:07:31 (EDT)
Your verey cool.
Melissa 6 102
USA - Wednesday, June 02, 2004 at 20:52:54 (EDT)
Mr.stien shcool is fun.I like when I slap your hand.I hope you like
my message.Thank you.
Melissa 6 102
USA - Wednesday, June 02, 2004 at 20:49:31 (EDT)
Mr.stien shcool is fun.I like when I slap your hand.I hope you like
my message.Thank you.
Melissa 6 102
USA - Wednesday, June 02, 2004 at 20:49:31 (EDT)
Mr.Gelber,the word of the day is auspicious.Yesterday word was dulcet.Its
going to be a auspicious day.Mr.Gelber no one at table four get to go on
the computer!!!!!!!!!!!!!!!!
Colleen 8 204 ps101
USA - Wednesday, June 02, 2004 at 19:34:39 (EDT)
DearMr.Gelber,I learned that you did not live in a log cabin.I learned
that you were born in Flushing.You were not born in Spain.
sakura,7,204,ps101
USA - Wednesday, June 02, 2004 at 17:18:39 (EDT)
Claudia, I may not be rich but I am not poor. As the song says,
"If i were a rich man....."
Mr. Gelber 204 101
USA - Wednesday, June 02, 2004 at 14:28:57 (EDT)
Claudia, I may not be rich but I am not poor. As the song says,
"If i were a rich man....."
Mr. Gelber 204 101
USA - Wednesday, June 02, 2004 at 14:28:52 (EDT)
Dear Mr.Gelber, Mr.Gelber you are poor.
Claudia7204
USA - Wednesday, June 02, 2004 at 14:23:02 (EDT)
Dear Mr.Gelber, The word of the day is auspicios. Today should be
auspicios.
Claudia 7 204
USA - Wednesday, June 02, 2004 at 14:19:51 (EDT)
Mr.Stine. I am haveing a new baby, he is keep crying, he have a
name, but I do not want to tell you whath is his name.
Rowena 6 k011
USA - Wednesday, June 02, 2004 at 09:47:41 (EDT)
Mr.Gelber I found the word of the day.The word of day is auspicious.
It is going to be a auspicious day.
chanel 8 204 ps101
USA - Wednesday, June 02, 2004 at 08:57:46 (EDT)
just wanted to say hi to anna maria (7) hope you are ok and studying
hard cant wait to see u soon be good and say hi to your friends
dale hardcastle
london, UK - Wednesday, June 02, 2004 at 08:49:45 (EDT)
Mr.Gelber There were 3 ships the nina,pinta,and the santa maria.
The Gelber ship got lost in the Alantic ocean. Mr.Gelber sailed with Cristafer
columbus.
chanel 8 204 ps101
USA - Wednesday, June 02, 2004 at 08:45:40 (EDT)
Mr.Gelber I found the word of the day. The word of the day is auspicious.I
can use it in a sentence.Auspicious starts the day.
chanel 8 204 ps101
USA - Wednesday, June 02, 2004 at 08:34:08 (EDT)
Claudia, Colleen, Justin, Omri, Samantha, Elijah and Eric, Great
job finding the word of the day. You each earned 20 points for your table.
Omri,There were 3 ships that came to America. The 4th ship, The Gelber
Ship got lost ("Don't leave home without a compass"). That is why we went
from Spain in 1492 to the Ukraine. It was my brave grandfather who came
to America in 1904. The Gelbers came to America for freedom. This year
we CELEBRATE 100 years in America. :)
Mr. Gelber 204 101
USA - Wednesday, June 02, 2004 at 07:00:04 (EDT)
Claudia, Colleen, Justin, Omri, Samantha, Elijah and Eric, Great
job finding the word of the day. You each earned 20 points for your table.
Omri,There were 3 ships that came to America. The 4th ship, The Gelber
Ship got lost ("Don't leave home without a compass"). That is why we went
from Spain in 1492 to the Ukraine. It was my brave grandfather came to
America in 1904. The Gelbers came to America for freedom. This year we
CELEBRATE 100 years in America. :)
Mr. Gelber 204 101
USA - Wednesday, June 02, 2004 at 06:59:22 (EDT)
I like the giraffe.
Gabriella, 5, Pre-K2, Tutortime
Bayside, NY USA - Tuesday, June 01, 2004 at 19:54:07 (EDT)
Dear Mr.Gelber The word of the day is dulcet. The music was dulcet.
Claudia 7 204
USA - Tuesday, June 01, 2004 at 19:07:24 (EDT)
I'm bored...me too i'm bored..SO BORED!
Jonette and Jabir
USA - Tuesday, June 01, 2004 at 18:50:03 (EDT)
I love your website.
Toma 5 K-o13 ps101
USA - Tuesday, June 01, 2004 at 18:47:22 (EDT)
LaLaLaLa
dfgadf
USA - Tuesday, June 01, 2004 at 17:35:28 (EDT)
Mr.Gelber,I know what the word of the day is.The word of the day
is dulcet.I heard great dulcet at a concert.
Colleen 8 204 ps101q
USA - Tuesday, June 01, 2004 at 17:18:15 (EDT)
hi mr. gelber. the word of the day is dulcet. the music from the
flute was so dulcet.
justin class 204 ps101
USA - Tuesday, June 01, 2004 at 17:18:12 (EDT)
hi mr. gelber. the word of the day is dulcet. the music from the
flute was so dulcet.
justin class 204 ps101
USA - Tuesday, June 01, 2004 at 17:18:11 (EDT)
hi mr. gelber. the word of the day is dulcet. the music from the
flute was so dulcet.
justin class 204 ps101
USA - Tuesday, June 01, 2004 at 17:18:08 (EDT)
hi mr. gelber. the word of the day is dulcet. the music from the
flute was so dulcet.
justin class 204 ps101
USA - Tuesday, June 01, 2004 at 17:18:07 (EDT)
Dear Mr.Stein I love computer class.DodgeSquare is so hard.I like
it. It is so cool.Your Best Friend,Adela.
Adela 7 103
USA - Tuesday, June 01, 2004 at 17:17:03 (EDT)
Dear Mr.Stein I love computer class.DodgeSquare is so hard.I like
it. It is so cool.Your Best Friend,Adela.
Adela 7 103
USA - Tuesday, June 01, 2004 at 17:17:01 (EDT)
That was a blackmail!!!!!
Jabir class 602
USA - Tuesday, June 01, 2004 at 13:57:08 (EDT)
WOA! how'd ya get 64 secs 4 the dodge square game? i can only last
up 2 30 secs...lol
Jonette
USA - Tuesday, June 01, 2004 at 13:50:09 (EDT)
YAY! I got 64 seconds in the dodge square game ... if u dont believe
me ask benny or jhostin.
Jabir class 602
USA - Tuesday, June 01, 2004 at 13:45:58 (EDT)
Dear Mr Gelber, Delcet is the word of the day. The music was delcet
to my ears.
Hannah 7 202
USA - Tuesday, June 01, 2004 at 13:31:36 (EDT)
Mr.Gelber The 4 ships are the Nina ,Pinta,and the Santa Maria. They
got lost in the Atlantic ocean. They sailed with Christopher Columbus.
omri 7 204 ps101q
USA - Tuesday, June 01, 2004 at 11:14:53 (EDT)
Mr.Gelber The word of the day is dulcet.I can use it in a sentence.I
can hear dulcet.
omri 7 204 ps101q
USA - Tuesday, June 01, 2004 at 11:03:20 (EDT)
Mr.Gelber,The word of the day is dulet. I can use it in a sentence.
A ukualali is dulet.
Samantha, 7, 204, 101
New York, N.Y.. USA - Tuesday, June 01, 2004 at 10:46:36 (EDT)
Mr. Gelber, The word of the day is dulet. I can ues in a sentence.
I went to a cosert I thought the guatar solo was great I say it had a great
dulet.
Elijah 8 2-204 P.S.101
USA - Tuesday, June 01, 2004 at 10:21:21 (EDT)
Mr. Gelber, I found the word of the day. It is dulcet.I can use
it in a sentence.The dulcet soots in my ear.
Eric 8 2-204 ps101
USA - Tuesday, June 01, 2004 at 09:47:29 (EDT)
Dulcet soots in my ears
Eric 8 2-204 ps101
USA - Tuesday, June 01, 2004 at 09:05:17 (EDT)
The muisc soots in my ear.
Eric 8 2-204 ps101
USA - Tuesday, June 01, 2004 at 09:00:56 (EDT)
Mr. Gelber, There are 4 ships one is Nina Pinta and the santa maria
and the Gelber ship.He got lost in the Atlantic ocean.He sailed with Cristafer
columis.
eric 8 2-204 ps101
USA - Tuesday, June 01, 2004 at 08:57:52 (EDT)
Mr. Stein, I saw the parade.
Kevin
ny USA - Monday, May 31, 2004 at 13:29:59 (EDT)
Hi! I'm Mary Kathe's cousin! Uh? That's it! Bye!
Liza Molloy
Albany USA - Monday, May 31, 2004 at 12:35:39 (EDT)
To Mr. Stein I like your computer.It is very cool and I hope you
get my message. FROM HELENA
Helena age 8 203 p.s. 101
USA - Sunday, May 30, 2004 at 21:38:29 (EDT)
MR STEIN"S MESSAGE TO:To Joanne 10 402, PS101. To get weird movie
gou to Downloads http://www.emaginatorium.com/101web/screensavers/screensavers.html
Let me know if it works. Have a happy Holiday.
Mr. Stein
USA - Saturday, May 29, 2004 at 19:51:50 (EDT)
Mr stein, how do u put a guestbook on a webpage?
Jonette
USA - Saturday, May 29, 2004 at 18:23:58 (EDT)
mr.stein could you put the weird movie in the website!
joanne10402ps101
foresthills, ny USA - Saturday, May 29, 2004 at 13:13:08 (EDT)
I like eggs
andy 6 k-012
USA - Saturday, May 29, 2004 at 11:15:07 (EDT)
I snap my finger
eric 8 2-204
USA - Saturday, May 29, 2004 at 06:30:52 (EDT)
I hope i win the shell game contest!
Jonette
USA - Friday, May 28, 2004 at 21:46:09 (EDT)
Mr.Stein I am going to disneyworld in Florida.
Kathy 5 k-013
USA - Friday, May 28, 2004 at 20:45:34 (EDT)
my favors animal si a dog
k.o14 6
USA - Friday, May 28, 2004 at 19:15:43 (EDT)
I read Mr.gelber's autobiography. I learned Mr.gelber can sometimes
be funny, sometimes
c.d.
USA - Friday, May 28, 2004 at 12:57:29 (EDT)
Hey kids, I hope you are enjoying the photojournalism class
Ms. Perle
USA - Friday, May 28, 2004 at 11:54:42 (EDT)
To Class K-013 You are wonderful. I like everyone in this class.
please write me over the vacation..... Tell me the fun things you are doing.
I may write you back....
Mr. Stein Computer Teacher
USA - Friday, May 28, 2004 at 09:40:49 (EDT)
Mrstin i live you
Toma 5
USA - Friday, May 28, 2004 at 09:35:44 (EDT)
lalahaha
Andy 5
USA - Friday, May 28, 2004 at 09:35:04 (EDT)
is the compputrman megaman
kevin
USA - Friday, May 28, 2004 at 09:34:43 (EDT)
i like snake
Andy
USA - Friday, May 28, 2004 at 09:32:22 (EDT)
mistr stin is a fake
julia 5
USA - Friday, May 28, 2004 at 09:31:00 (EDT)
Mr.stien your cool and I hope you will like this.Thank you.
Melissa 6 102
USA - Thursday, May 27, 2004 at 18:44:52 (EDT)
Mr.Stien you are a verey good teacher.You teach a lot.You are fun.I
like what you teach it is graet.I like the websites there cool and you
are cool to.I hope you like the message. Thank you.
Melissa 6 102
USA - Thursday, May 27, 2004 at 18:37:09 (EDT)
ha MrStean you are cool.
nathaila
103, USA - Thursday, May 27, 2004 at 13:58:04 (EDT)
shiraps1o1q1o26
USA - Thursday, May 27, 2004 at 12:56:16 (EDT)
mestr stin i like kum mr.Stein i like computer because i like to
tyep.
shiraps1o1q1o26
USA - Thursday, May 27, 2004 at 12:55:32 (EDT)
ilove you /. ga ga gu gu.
Daniel t 1 102
USA - Thursday, May 27, 2004 at 12:53:12 (EDT)
Dear Mr. D Berry I love your games on the computer.
Yakubmier 7 p.s.101
USA - Thursday, May 27, 2004 at 12:43:39 (EDT)
Your computer room is great.I wish I could come here every day.
Yoni 6 102 P.S.101
New York, N.Y. USA - Thursday, May 27, 2004 at 12:39:13 (EDT)
Dear Mr.Stein, I like to listen to your mouse dance and your alien
dance.David
David 7 102 P.S.101
USA - Thursday, May 27, 2004 at 12:32:30 (EDT)
Hi mr stein i think your cool: ) I like computers
Tylah 9
forrest hills, N.Y USA - Thursday, May 27, 2004 at 11:11:20 (EDT)
Dear mr stine i Like computer
Joshua 5 k-014
New york, NY USA - Thursday, May 27, 2004 at 10:08:23 (EDT)
Dear Mr. Stine one thing I like about your web sight is that you
put alote of cool stuff and fun things .And the second thing I like about
your web sight is you Made us go on a mind journy.
Olivia 8 201
USA - Thursday, May 27, 2004 at 09:48:40 (EDT)
dear Mr.Stein, i think computers are the best.Im so glad we have
computers at school.I have a computer at home but theres always a special
show on 49 and I like it when its done. I fell like going on the computer
but my sister is on it doing what give up chating on the internet. love
all your activities that you plan for first second
alana 8 2-201 PS101
USA - Thursday, May 27, 2004 at 09:44:34 (EDT)
dear Mr.Stein, i think computers are the best.Im so glad we have
computers at school.I have a computer at home but theres always a special
show on 49 and I like it when its done. I fell like going on the computer
but my sister is on it doing what give up chating on the internet. love
all your activities that you plan for first second
alana 8 2-201 PS101
USA - Thursday, May 27, 2004 at 09:44:34 (EDT)
Deardad,Can I have a coumpoter in my house plese.
eric8201
USA - Thursday, May 27, 2004 at 09:35:30 (EDT)
Dear mr. Stein my favorite things are the skelten, madcow diesies,
strech mr joseph,season greetings
Granit 8 Class 2-201
Forest Hills, ny USA - Thursday, May 27, 2004 at 09:31:02 (EDT)
Dear mr.stien i like the soda straw. By;Amane
Amane, 8, 201, p.s.101
New york, Ny USA - Thursday, May 27, 2004 at 09:27:41 (EDT)
dear mr stein I like how you Think and found all new thing
Ester 7 201
USA - Thursday, May 27, 2004 at 09:26:10 (EDT)
Dear mr. stein I like soda straw the best
Matthew 7 201
USA - Thursday, May 27, 2004 at 09:24:47 (EDT)
dear mr stein I like how Think and found all new thing
Ester 7 201
USA - Thursday, May 27, 2004 at 09:24:43 (EDT)
dear mr stein I like how Think and found all new thing
Ester 7 201
USA - Thursday, May 27, 2004 at 09:24:11 (EDT)
dear mr.stine,my favorite parts of your web site is the fireworks,gustbook
and alien.
sabrina,7,201
USA - Thursday, May 27, 2004 at 09:23:35 (EDT)
dear mr.stein, i like the game who am i. it's a fun game. u should
play it
valentina.8.2-201.ps101
USA - Thursday, May 27, 2004 at 09:22:39 (EDT)
DearMr.Stien, computers are nice.
Maya 8 202 ps101
USA - Thursday, May 27, 2004 at 09:05:33 (EDT)
DearMr.Stien, I need a computer.
Maya 8 202 ps101
USA - Thursday, May 27, 2004 at 09:02:54 (EDT)
DearMS.Stien What I lik about computers is you. you are the best.ILOVE
YOU .BIANCA
Bianca 8 Class 202
USA - Thursday, May 27, 2004 at 09:01:44 (EDT)
DearMr.Stien, I really like computers.
Maya 8 202 ps101
USA - Thursday, May 27, 2004 at 09:00:20 (EDT)
MR.sTIEN, I love your computer mr stien. by alexis roth
ALEXIS7202
USA - Thursday, May 27, 2004 at 08:58:31 (EDT)
i love coumpers
Jacklyn 7 202
USA - Thursday, May 27, 2004 at 08:58:23 (EDT)
I like you computer abot coring book.
Natthinee 9 202 PS101Q
NY USA - Thursday, May 27, 2004 at 08:58:16 (EDT)
DearMr.Stien, I have a computer.
Maya 8 202 ps101
USA - Thursday, May 27, 2004 at 08:57:51 (EDT)
MR.sTIEN, I love your computer mr stien. by alexis roth
ALEXIS7202
USA - Thursday, May 27, 2004 at 08:57:50 (EDT)
My favorite thing in computer is writing messages.
moe 8 202
USA - Thursday, May 27, 2004 at 08:54:23 (EDT)
DearMr.Stien, You can do your homework on the computer.
Maya 8 202 ps101
USA - Thursday, May 27, 2004 at 08:54:13 (EDT)
Dear Mr.Stein, I love computers!
Anna Maria 7 2-202 ps101
USA - Thursday, May 27, 2004 at 08:51:50 (EDT)
DearMr.Stien, I like computers because they are fun.
Maya 8 202 ps101
USA - Thursday, May 27, 2004 at 08:50:02 (EDT)
DearMr.Stien, I like computers because they are fun.
Maya 8 202 ps101
USA - Thursday, May 27, 2004 at 08:49:44 (EDT)
dear mr.stein,I like computers because you are the best!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Maria 8 202
ny USA - Thursday, May 27, 2004 at 08:47:47 (EDT)
the best thing in computer is mr.stein.
isabella 7 202 ps101
USA - Thursday, May 27, 2004 at 08:47:29 (EDT)
Dear Mr.Gelber, You were born in Flushing Hospital. You are bilingo.
You are a poor teacher.:)
Claudia, 7, 204
USA - Wednesday, May 26, 2004 at 20:46:51 (EDT)
Dear Mr.Stein, I showed my dad and my brother,Eli the alien and
mouse dance. Love,Justin
Justin 102 P.S.101
USA - Tuesday, May 25, 2004 at 20:37:52 (EDT)
Dear Mr.Stein, In class we have been writing facts about states
(,in the U.S.)Mrs.Grossman reads us the facts.Our class wrote about New
York,Minnesota,New Mexico,Florida,Texas and California.I almost wrote a
whole page on every state. Love, Justin
Justin 102 P.S.101
USA - Tuesday, May 25, 2004 at 20:16:09 (EDT)
Samantha, Thanks for all those facts about me. I still think that
makes me a Native American. Am I wrong?????????????????
Mr. Gelber 204
USA - Tuesday, May 25, 2004 at 15:34:19 (EDT)
Dear Mr.Stein, This Wednesday I am going to Fun Zone.Fun Zone is
located in Babylon. Love,Justin
Justin 6 102 P.S.101
USA - Tuesday, May 25, 2004 at 13:00:08 (EDT)
I could read the top "New York City Department of Education,Region
3 Public School 101Q,The Emaginatorium Computer Lab.
Daniel Z. 6 102 P.S.101
New-York, N.Y USA - Tuesday, May 25, 2004 at 12:52:40 (EDT)
Dear Mr.Stein, Yesterday afternoon I made a huge times table.I made
it at my afterschool. Love,Justin
Justin 6 102 P.S.101
USA - Tuesday, May 25, 2004 at 12:51:11 (EDT)
you rock . you are like a rockstar . pleas put on a show.
daniel 6/7 102 ps.101
USA - Tuesday, May 25, 2004 at 12:46:33 (EDT)
I learned three facts about Mr.Gelber. They are ... 1. Mr. Gelber's
family was born in Russia. 2. Mr. Gelber's family was born in Isreal. 3.
Mr. Gelber's family was born in Spain. 4. Mr. Gelber was born in Flushing.
5. Mr. Gelber is a Native. 6. Mr. Gelber is a American.
Samantha,7,204,101
Forest Hill, N.Y. USA - Monday, May 24, 2004 at 20:29:37 (EDT)
i'm glad that jabir won the dragon animation contest!
jonette
USA - Monday, May 24, 2004 at 18:37:33 (EDT)
I HOPE I WIN THE SHELL GAME CONTEST!! IT"S ALMOST JUNE!!
Jonette
USA - Monday, May 24, 2004 at 18:32:27 (EDT)
How to get a coputer is graet. I could use that for my parents.
Paola,11,602,101ps Q
Queen, NY USA - Monday, May 24, 2004 at 14:23:27 (EDT)
On Saturday I saw five short performance then at the same place
we had a barbeque after that we had a water fight.
Paulina 6 103 ps101
USA - Monday, May 24, 2004 at 09:52:25 (EDT)
My dad is great because he cares about me and sometimes he buy things
for me and I really liked the derss that yo
Krishangi ps101 6
USA - Monday, May 24, 2004 at 09:04:57 (EDT)
Dear Mr.Stein,last Sunday my whole family and I went to a party
it was my mom's friend birthday.I played with her son,he is bigger than
I.He gave me a piggy back ride.We had a barbeque.
Eileen 7,103 PS101
USA - Monday, May 24, 2004 at 09:03:29 (EDT)
MY Father is the best
Taro,6,103,ps101
New York, UN USA - Monday, May 24, 2004 at 08:59:40 (EDT)
Dear Mr.stein My dad is the best because he go to work for us and
spend money for us and dont let us lose uwer home
Leah7, 103 ps101
USA - Monday, May 24, 2004 at 08:58:04 (EDT)
My dad is the best because he is nice and he is silly.
Natalie 6 103 ps101.
USA - Monday, May 24, 2004 at 08:56:39 (EDT)
My dad takes me to the park
christopher 6 103
USA - Monday, May 24, 2004 at 08:52:36 (EDT)
My dad is the best because he takes me to difrent fun places.
mike 7 103
USA - Monday, May 24, 2004 at 08:50:53 (EDT)
my dad is the best because he takes me to difrent fun places.
mike 7 103
USA - Monday, May 24, 2004 at 08:50:14 (EDT)
My dad is the best.
NEIL7,103 PS101
USA - Monday, May 24, 2004 at 08:48:27 (EDT)
My dad is the best
Bodhi 6 class 103
USA - Monday, May 24, 2004 at 08:47:57 (EDT)
my dad is the best
kamal
USA - Monday, May 24, 2004 at 08:44:05 (EDT)
Justin and Igor, Thanks for reading my autobiography. Justin, I
was not born in a log cabin, that was Abe Lincoln.I was born in Flushing
Hospital. I'm a native of Queeens. That must make me a Native American.
Huh? Can that be right???????? Igor, my family actually did leave Spain
at about the same time Columbus did. Could you imagine if the Gelber ship
actually came with Columbus what would have happened? Mr. Columbus would
be your teacher and i would have a holiday off (Gelber Day). History would
be so much different today. :)
Mr. Gelber 204 101
USA - Sunday, May 23, 2004 at 17:16:38 (EDT)
MY GRANDPARENTS WENT TO CHINA MY FRIEND GRANDMA IS GOING TO BABYSIT
ME
isabella 5 k012
USA - Sunday, May 23, 2004 at 16:52:06 (EDT)
my mom is going to have a baby! IM SO HAPPY
isabella 5 k012
USA - Sunday, May 23, 2004 at 16:46:59 (EDT)
dear mr stein i went to American Museum of Natural History wow it
is so cool or should i say awesome
isabella 5 k012
USA - Sunday, May 23, 2004 at 16:44:11 (EDT)
Mr Stein i have something for you.
Toma ko13 ps101
USA - Sunday, May 23, 2004 at 08:10:16 (EDT)
MR. STEIN'S MESSAGE TO JONETTE AND JABIR: SORRY> I WILL HAVE TO
REPOST YOUR 3RD AND WINNING ANIMATION. MESSAGE TO KRISHEN: HOW IS THE WEATHER
IN CENTRAL PARK? SEE YOU ALL MONDAY
Mr. Stein
USA - Saturday, May 22, 2004 at 23:55:41 (EDT)
hello mr. stein, i hope you are having a good weekend! i am in central
park.
krishen , 6, ko13, ps, 101
ny, ny USA - Saturday, May 22, 2004 at 18:34:16 (EDT)
2 MR STEIN-- Where is Jabir's 3rd animation??
Jonette
USA - Saturday, May 22, 2004 at 14:56:24 (EDT)
YEA JABIR WON!!!! I'll tell him the good news!
Jonette
USA - Saturday, May 22, 2004 at 14:55:06 (EDT)
I loved your website. I found the topics you offered to both parents
and students very interesting. My son goes to P.S.153Q. Mr. Gelber is an
old friend of mine, and a wonderful teacher and person.
Karen Garone
Queens, NY USA - Saturday, May 22, 2004 at 10:22:01 (EDT)
CONGRATULATIONS TO JABIR, You have won the animation contest. Please
come to me MONDAY so to remind me to make a loudspeaker announcement. Please
come to me to pick up your prize. You did an excellent job.
Mr. STEIN
USA - Saturday, May 22, 2004 at 06:56:17 (EDT)
MR.STEIN'S MESSAGE TO: Mary Kathe S.: I did not have time to post
your sound file to our web page. Please remind me on MOnday. Say hello
to your Mom. Hey. Why not record a sound file at home. Name it the correct
way and attach it as a file and email it to me at emaginatorium@aol.com.
ThenI can do it from home. Make sure to tell me about it on the guest book.
CIAO
MR. STEIN
USA - Saturday, May 22, 2004 at 06:54:45 (EDT)
MESSAGE TO:Kelly M., 6, 102, ps101****I AM SO PROUD OF YOU. YOU
RECORDED A SOUND FILE AT HOME AFTER JUST ONE LESSON. DID YOU SAVE IT WITH
THE CORRECT FILE NAME? DID YOU SAVE IT IN MY DOCUMENTS FOLDER? PLAY IT
BACK FOR YOUR PARENTS AND TELL MEWHAT THEY SAY. YOU ARE SO SMART!!!!
MR. STEIN
USA - Saturday, May 22, 2004 at 06:50:34 (EDT)
Hi Mr.Stein! I really miss my old school and my class. How are you
doing? Say hello to grade 3 for me please. I hope you guys miss me too.
Say hello to Mr.Joseph too,my dad says hi to him too. He also misses P.S.101.PLEASE
read this message with GRADE 3!!!!!!!!!!!!!!!!!!!!!!! Bye!!!
Sarah D. 9 grade3 Kew Forest
N.Y., N.Y. USA - Friday, May 21, 2004 at 19:47:30 (EDT)
My dad liked the Eagle the best.
kathy 5 k-013
USA - Friday, May 21, 2004 at 18:18:24 (EDT)
I had made a voice mail. thank you!
Kelly M., 6, 102, ps101.
USA - Friday, May 21, 2004 at 18:03:15 (EDT)
Hi Mr. Stein when is my "How to get a Computer" recorded sound going
to be posted? When it is tell me what number I am (like 1,2,3,4,5,6,YOU
GET IT!!) Thank you!
Mary Kathe S.
Forest Hills , N.Y. USA - Friday, May 21, 2004 at 10:34:42 (EDT)
Hi ppl! mr. stein! who won the dragon animation contest?
Jonette 601
USA - Thursday, May 20, 2004 at 20:10:46 (EDT)
I like Claudia
Taylor Class: 4000000000000002
USA - Thursday, May 20, 2004 at 17:32:53 (EDT)
hi! mr.stein i came back from after school im a mess well ill see
u on friday. Bye!
Laureta L. 10,503
new york, ny USA - Wednesday, May 19, 2004 at 19:44:35 (EDT)
Dear Mr.Stine Today is my birthday, May 19. I had a party, it was
too fun. I had a too too too too too too too too too too too too too too
too fun, i gave my friend party bag, i had party bag too.
Rowena 6 k011
USA - Wednesday, May 19, 2004 at 17:25:52 (EDT)
Mr. Gelber is multilingual Mr. Gelber's wrote a joke about his ship
leaving with Columbus. Mr. Gelber's Grandfather lived in The Ukraine and
left for New York in 1904.
Igor Vega, 8, 204, PS101
Forest Hills, NY USA - Tuesday, May 18, 2004 at 22:56:08 (EDT)
sorry mr. gelber i forgot where to go to read about you
justin 7 204 ps101
NY USA - Tuesday, May 18, 2004 at 22:46:27 (EDT)
hi mr. gelber i know you were born in a log cabin.Almost 4 ships
came to america.you can speak in french,hebrew,spanish,and yiddish
justin 7 204 ps101
USA - Tuesday, May 18, 2004 at 22:40:48 (EDT)
Samantha, Hooray! (Clap clap clap) (clap) (clap clap clap) (clap)
Now repeat the poem in class (first raise your hand and wait to be called
on) to get 10 points for your table. :) I feel so happy that my students
are motivated and learning.
Mr. Gelber 204 PS101
USA - Tuesday, May 18, 2004 at 21:42:13 (EDT)
Dear Alicia and Colleen, Terrific! Out-of-sight! Way-to Go! I'm
so glad that read my autobiography under Teachers and classes. You listed
3 facts that you learned and then posted your response to the guestbook.
You each get 10 points toward Center Time on Friday! Teacher: Clap clap
clap. Students: Clap Teacher: Clap, clap, clap Students: Clap Teacher:
Clap, clap, clap Students: Clap That's class 2-204's way of going Hooray!
Hooray! Hooray! Would anyone else like to try and earn points toward Center
Time?
Mr. Gelber 204 PS101
USA - Tuesday, May 18, 2004 at 21:36:53 (EDT)
Dear Mr.Gelber, I read your autobiography. I will tell you what
I learned:You were born in Flushing, your family lived in several continents
and met important people, also I learned that you and your family stayed
in the Ukraine when you got lost, so you and your family stayed there until
400 years and until your grandfather left NY in 1904. Well, that;s all
folks!
Alicia 7 2-204
USA - Tuesday, May 18, 2004 at 18:13:20 (EDT)
Dear Mr.Gelber, I saw your autobiography.Your family lived in many
continents.You guys met alot of important people in the history.Your family
sailed on the same day as Christopher Columbus.If you were sailing with
Columbus,the hoilday would be call Gelber Day.I already done my homework.Don't
worry!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Bye Mr.Gelber!
Colleen 8 204 ps101
USA - Tuesday, May 18, 2004 at 17:01:26 (EDT)
Who won the dragon animation contest?? DID JABIR WIN?? I HOPE HE
DOES!!
Jonett
USA - Monday, May 17, 2004 at 20:53:24 (EDT)
Dear Mr.Gelber, 30 days have September,April,June,and November.
All rest have 31 execpt Febuary 28 leapyear 29
Samantha 7 204 PS101
Forest Hills, NY USA - Monday, May 17, 2004 at 20:34:55 (EDT)
Dear Mr.Gelber, 30 days have September,April,June,and November.
All rest have 31 execpt Febuary 28 leapyear 29
Samantha 7 204 PS101
Forest Hills, NY USA - Monday, May 17, 2004 at 20:29:52 (EDT)
i got a computer ,no i didnt
dan 12 602 ps101
USA - Monday, May 17, 2004 at 08:43:09 (EDT)
In August I am going to Florida.
kathy 5 k-013
USA - Sunday, May 16, 2004 at 21:56:08 (EDT)
thank you for your message. Mr.Stien
KATHY 5
USA - Sunday, May 16, 2004 at 21:47:40 (EDT)
TO JONETTE AND JABIR: I POSTED YOUR NEW DRAGON ANIMATION. I THINK
IT IS BETTER NOW THAT SOME FRAMES ARE LONGER. CIAO, MR. STEIN
Mr. Stein
USA - Sunday, May 16, 2004 at 21:42:24 (EDT)
MESSAGE TO kathy 5 k-013: THANK YOU FOR LETTING ME KNOW THAT YOUR
TOOTH FELL OUT. I HOPE IT DID NOT HURT. WILL YOU PRINT A TOOTH FAIRY ENVELOPE
FROM OUR WEBSITE? TOOTH FAIRIES LOVE THAT ENVELOPE> I BELIEVE THAT THEY
LEAVE NICER GIFTS> MAKE SURE THAT YOU DRAW YOUR FACE ON THE ENVELOPE. THIS
WAY THE TOOTH FAIRY WILL KNOW IT IS YOU. LET ME KNOW WHAT HAPPENS.....MR.
STEIN
MR. Stein
USA - Sunday, May 16, 2004 at 21:41:04 (EDT)
MR.STEIN ON AUGIST I AM GOING TO FORDA
kathy 5 k-013
USA - Sunday, May 16, 2004 at 21:40:39 (EDT)
MR.STEIN ON AUGIST I AM GOING TO FORDA
kathy 5 k-013
USA - Sunday, May 16, 2004 at 21:40:39 (EDT)
MR.STEIN ON AUGIST I AM GOING TO FORDA
kathy 5 k-013
USA - Sunday, May 16, 2004 at 21:40:39 (EDT)
Mr.Stein my tooth fell out today and I am going to send it to the
tooth fariy
kathy 5 k-013
USA - Sunday, May 16, 2004 at 21:11:06 (EDT)
2 JABIR: then where is it??
Jonette
USA - Sunday, May 16, 2004 at 20:44:05 (EDT)
2 JONETTE: I sent my slower version of my third animation
Jabir
USA - Sunday, May 16, 2004 at 15:41:39 (EDT)
MESSAGE TO JONETTE and JABIR: ASK JABIR TO MAKE THE ANIMATION SLOWER.,
SEND IT TO ME, AND NOTIFY ME ON THIS GUEST BOOK. I WILL POST THE NEW ONE.
HAPPY WEEKEND,
Mr. Stein
USA - Sunday, May 16, 2004 at 10:45:48 (EDT)
TO MR. STEIN....can u plz make jabir's 3rd animation a bit slower
plz..coz it's goin too fast!
Jomette
USA - Sunday, May 16, 2004 at 09:52:34 (EDT)
I also hope that i win the shell game contest!
Jonette
USA - Saturday, May 15, 2004 at 15:37:04 (EDT)
TO MR. STEIN-- does jabir win the dragon animation contest?? i hope
he does
Jonette
USA - Saturday, May 15, 2004 at 15:36:29 (EDT)
I'm still in San Jose. It's pretty early now, here, 6:35am. I'm
returning to New York today after I play my pieces at the competition and
maybe get the results back. California is very differnt from New York I
can tell.
Amy 9 401
San Jose, CA USA - Saturday, May 15, 2004 at 09:37:07 (EDT)
I'm still in San Jose. It's pretty early now, here, 6:35am. I'm
returning to New York today after I play my pieces at the competition and
maybe get the results back. California is very differnt from New York I
can tell.
Amy 9 401
San Jose, CA USA - Saturday, May 15, 2004 at 09:36:36 (EDT)
I'm still in San Jose. It's pretty early now, here, 6:35am. I'm
returning to New York today after I play my pieces at the competition and
maybe get the results back. California is very differnt from New York I
can tell.
Amy 9 401
San Jose, CA USA - Saturday, May 15, 2004 at 09:35:57 (EDT)
DID I WIN?? wat do i win anyway?
Jabir
USA - Saturday, May 15, 2004 at 08:40:01 (EDT)
YEA JABIR IS GOIN 2 WIN!!!!! GOOD LUCK 2 JABIR!!! :-D
Jonette
USA - Saturday, May 15, 2004 at 08:36:56 (EDT)
**MESSAGE TO JABIR, 6214: I REALLY LIKE YOUR NEWEST ANIMATION. I
POSTED IT TO THE WEBSITE. I MUST BE HONEST AND SAY THAT TO MY MIND IT IS
THE BEST DRAGON ANIMATION SO FAR. I HOPE YOU WIN!!!!!
MR. STEIN
USA - Saturday, May 15, 2004 at 01:37:15 (EDT)
***MESSAGE FROMMR.STEIN TO: Amy 9 401- GOOD LUCK IN THE COMPETITION.
YOU ARE SO TALENTED! I HOPE YOU WIN.
Mr. Srein
USA - Saturday, May 15, 2004 at 01:05:24 (EDT)
Hello Mr.Stein, my dad and I flew to San Jose, Californa by airplane
today, on Friday. It's 9:30pm in California now. I believe it is about
12:30am in New York now. The reason I came to San Jose is to play in a
Russian composer piano competition. By the way, I'm in the hotel now, typing
on the computer internet.
Amy 9 401
San Jose, CA USA - Saturday, May 15, 2004 at 00:29:58 (EDT)
Do you know what days of I hate? They are monday and friday.
Julia 5 k-014
USA - Thursday, May 13, 2004 at 18:43:31 (EDT)
In Florida I saw MICKEY AND MINEY ON A PRAID FROM TAYLOR TO MR STINE
Taylor 6 101 ps101
NewYork, USA USA - Thursday, May 13, 2004 at 15:51:31 (EDT)
Hey Mr.Stein! It is soooo HOT !!!!!!!! Will it EVER stop !!!!!!
PLEASE !!! make it stop !!!!!
Anomynous
USA - Thursday, May 13, 2004 at 13:54:50 (EDT)
Mr. Stein it is so hooooooooooooottttttt!!!!!!!!!!!!!!!!! WHEN WILL
THIS HEAT END!!!!!!!!!!!!!!!!!!!
Anonyumus
- Thursday, May 13, 2004 at 13:42:42 (EDT)
***MESSAGE FROM MR. STEIN TO:Amy 9 401, YOUR ANIMATION IS GREAT!!!!
WAIT TIL THE STUDENTS SEE IT. I WILL POST IT TOMORROW. MESSAGE TO: Taylor
6 101 PS101: I AM HAPPY YOU ENJOYED FLORIDA. DID YOU GET A PICTURE WITH
MICKEY AND MINNIE. WE CAN PUT IT ON THE USA MAP> SEE YOU TOMORROW.
Mr. Stein
USA - Wednesday, May 12, 2004 at 22:06:17 (EDT)
I made another animation from GIF Movie Gear.
Amy 9 401
Forrest Hills, NY USA - Wednesday, May 12, 2004 at 18:24:47 (EDT)
Florida was very eciding because I saw MICKEY AND MINEY >
Taylor 6 101 PS101
NewYork, USA - Wednesday, May 12, 2004 at 16:06:00 (EDT)
Florida was very eciding because I saw MICKEY AND MINEY >
Taylor 6 101 PS101
NewYork, USA - Wednesday, May 12, 2004 at 16:05:59 (EDT)
Florida was very eciding because I saw MICKEY AND MINEY >
Taylor 6 101 PS101
NewYork, USA - Wednesday, May 12, 2004 at 16:05:57 (EDT)
I just went on your website Mr.stine.
Taylor 6 101 Ps101
New York, USA USA - Wednesday, May 12, 2004 at 15:56:15 (EDT)
can you ples puton the moove
paul 5 k011ps101
USA - Wednesday, May 12, 2004 at 09:34:37 (EDT)
I like all the things you do.
Mikheal 7 201
New york city, NY USA - Tuesday, May 11, 2004 at 21:24:27 (EDT)
Hi
Stacy Halpern Teacher PS38Q
USA - Monday, May 10, 2004 at 19:05:48 (EDT)
you are crazy
no telling
- Sunday, May 09, 2004 at 14:27:31 (EDT)
I am so glad we are going outside.Good thing many peaple wanted
to go outside because I did too!!!
Raquel , 9 , 303
USA - Sunday, May 09, 2004 at 13:29:48 (EDT)
you are cool.
nathalia
USA - Sunday, May 09, 2004 at 13:12:49 (EDT)
mR.s, No matter what I do I can not download gif! cAN you help me!?!
oLIVIA
Olivia G. 10 401 ps101
Forest Hills, N.Y. USA - Saturday, May 08, 2004 at 18:17:03 (EDT)
***MESSAGE TO JABIR AND JONETTE****JABIR'S FIRST ANIMATION IS ON
THE WEBSITE. I WILL TRY TO GET THE SECOND ONE POSTED LATER.....HAVE A NICE
WEEKEND>>> :)
Mr. Stein
USA - Saturday, May 08, 2004 at 18:02:35 (EDT)
MRS STEIN....PLZ PUT JABIR'S 2ND ANIMATION THANK U!
Jonette
Jamaica, Ny USA - Saturday, May 08, 2004 at 17:33:39 (EDT)
I like www.neopets.com!!! Everyone should go there instead of ps101.webhp.org....this
website is fun not boring like ps101.webhop.org!!!
Lucy Li 602
Rego Park, NY USA - Saturday, May 08, 2004 at 14:30:44 (EDT)
my student # is 6214 and can u delete the first animation i sent
u cuz i made another 1 and sent it 2 u
Jabir class 602
USA - Saturday, May 08, 2004 at 14:29:44 (EDT)
Mrs. Bodenstein, Happy Mother's Day, and I do everything on your
schedule on the weekends; except the manicure part. I think my mom does
that.
Sam,9,303
USA - Saturday, May 08, 2004 at 08:15:11 (EDT)
***MESSAGE FROM MR. STEIN TO JONETTE J.: SORRY YOU DIDN'T WIN. THAT
CONTEST WAS FOR CLASS 101 ONLY. I WILL WORK ON PUTTING JABIRS ANIMATION
ONLINE.
MR. STEIN
USA - Saturday, May 08, 2004 at 07:56:52 (EDT)
Mr. Stein...can you put Jabir's animation on the web...so i can
see it? cause i wanna see which is the best so far...thankx
J . Jeter
Jamaica, NY USA - Friday, May 07, 2004 at 22:52:24 (EDT)
I KNOW WHAT WHAT'S THE NEXT WORD THAT MR. GELBER SAID!! IT'S WHICH!!
HE SAID, "EXCEPT FOR FEBRUARY WHCIH HAS 28 DAYS....." DO I WIN....AGAIN?!
Jonette Jeter(Pinedo)
Jamaica, NY USA - Friday, May 07, 2004 at 22:45:15 (EDT)
Hey sup ppl? i'm always having a boring weekend!! i already finish
my HW!!! the only thing i do is watch baseball, play baseball, and chat
w/ Jabir P.and other friends.....it's still boring...
Jonette Jeter(Pinedo)
Jamaica, NY USA - Friday, May 07, 2004 at 22:40:11 (EDT)
i sent u the dragon animation
Jabir
USA - Friday, May 07, 2004 at 19:24:36 (EDT)
CONTEST FOR CLASS 101 ONLY*** WATCH MR. GELBER'S VIDEO ABOUT THE
NUMBER OF DAYS IN EACH MONTH. ANSWER THIS QUESTION*** WHAT WORD DOES MR.
GELBER SAY AFTER THE WORD FEBRUARY? GOOD LUCK. THE FIRST THREE STUDENTS,
WITH THE CORRECT ANSWER, WILL GET A SWEET TREAT. HAVE A GOOD WEEKEND.....
MR. STEIN- COMPUTER TEACHER
USA - Friday, May 07, 2004 at 18:36:42 (EDT)
MESSAGE TO MS. BODENSTEIN- HAPPY MOTHER'S DAY. YOU MUST BE THE GREATEST
MOTHER.....I CAN TELL!
Mr. Stein
USA - Friday, May 07, 2004 at 18:30:15 (EDT)
Kats - I'm happy that you're happy about going outside. Now earn
the stars. Sam - I do everything on the weekends that I don't have time
to do during the week. I shop, clean, do laundry, see family, relax, and
get a manicure. Mr. Stein - have a Happy Mother's Day.
Mrs. Bodenstein 303
USA - Friday, May 07, 2004 at 18:02:17 (EDT)
Well, I see that Kats seems happy. I wonder how many people voted
for outside? Anyway, what do teachers do on weekends? Do they have a daily
shedule?
Sam,9,303
USA - Friday, May 07, 2004 at 17:10:12 (EDT)
Dear Mrs. Bodestien, Yes!!! I knew we would go outside. Hopefully
it will be good weather.
Kats T., 8, 303
NY, NY USA - Friday, May 07, 2004 at 14:58:51 (EDT)
Prof. Stein, check out the "Grady" entries. Grady students, print
out your Bar Graphs with your name on it for extra credit on Tuesday's
test.
Mr. Burke, Grady High School
Brooklyn, NY USA - Friday, May 07, 2004 at 10:46:13 (EDT)
Mr.burke,The dog was my favorite hand painting
Damond;14;grady
bklyn, ny USA - Friday, May 07, 2004 at 10:28:38 (EDT)
In April there are 31 days.
Gaby Emily W. 6 6 101 ps101
USA - Friday, May 07, 2004 at 09:00:32 (EDT)
Dear,Mr.Stien have a happy Mothers Day.
Anuj 6 101
USA - Friday, May 07, 2004 at 08:59:24 (EDT)
april has 30 days.
roxanne 7 101 ps101
USA - Friday, May 07, 2004 at 08:54:58 (EDT)
Dear,Mr.Stien have a happy Mothers Day.
Anuj 5 101
USA - Friday, May 07, 2004 at 08:54:42 (EDT)
30 days in april
harrison 7 101 ps101
USA - Friday, May 07, 2004 at 08:54:18 (EDT)
CONTEST FOR CLASS 101 How any days are in APRIL????
Mr. Stein
USA - Friday, May 07, 2004 at 08:49:50 (EDT)
The fifth word is September
Harrison 7 101 PS101
USA - Friday, May 07, 2004 at 08:39:19 (EDT)
CONTEST FOR CLASS 101*****WHAT IS THE 5TH WORD MR. GELBER SAYS IN
DAYS OF THE MONTH?
Mr. Stein
USA - Friday, May 07, 2004 at 08:37:13 (EDT)
Class 303: It looks like the majority vote is for playing outside
during your free time. Now earn the stars!!!!!!!!!
Mrs. Bodenstein 303
USA - Friday, May 07, 2004 at 06:33:27 (EDT)
Dear Mrs.B, We're this close to getting 10 stars. I think we should
spend free time playing games in the classroom. -S.L.L.
Sam,9,303
USA - Thursday, May 06, 2004 at 21:23:49 (EDT)
Mr. stein I don't have gif movie gear.How am I gonna do it . Help
me mr. stein please i'm beging you when I come tell me o.k. bye bye bye
bye bye bye for the last time i'm gonna say it BBBBBBBBBBBBBYYYYYYYYYYEEEEEEEEE!
Granit Class 201
Forest Hills, ny USA - Thursday, May 06, 2004 at 18:13:18 (EDT)
Dear mr.stein I found the last 3 letters in mr.gelber mounths its
a leap year .
Deniz 7204
USA - Thursday, May 06, 2004 at 14:29:22 (EDT)
Dear Mrs.Bodenstein, WE want to go outside.If it is raining I want
to do it the next day. -Jean
Jean L.,8,303,P.S.101
Forest Hills, USA - Thursday, May 06, 2004 at 11:35:34 (EDT)
Dear Mrs.Bodenstein, WE want to go outside.If it is raining I want
to do it the next day. -Jean
Jean L.,8,303,P.S.101
Forest Hills, USA - Thursday, May 06, 2004 at 11:35:32 (EDT)
Dear Mrs. Bondenstei, I want to go outside, but if it is raining
we may stay inside to play games.
James C. 9 P.S.101
Forest Hills, NY USA - Thursday, May 06, 2004 at 11:30:25 (EDT)
we want outdoors, bingo, twister.
Paula and Raquel 9,9 303
USA - Thursday, May 06, 2004 at 11:26:52 (EDT)
Maybe we should give children one more night to answer this question.
CHILDREN!!!!!!!! Otherwise, the yard wins.
Mrs. Bodenstein 303
USA - Thursday, May 06, 2004 at 06:40:39 (EDT)
Dear Ms. Boderstein, I would like to spend my free period creating
on the computer. Hahahahaha
Mr. Stein Computer Teacher
USA - Wednesday, May 05, 2004 at 21:32:28 (EDT)
Dear Ms. Bodenstein, I want to play games on our free-time and no
work. I also hope we get the other two stars.
Sawandia 8, 303, PS 101
Jamaica, N.Y USA - Wednesday, May 05, 2004 at 21:21:35 (EDT)
LETS DO ANYTING WE WANT(EXCEPT BEING BAD)
Stephen,9,303
USA - Wednesday, May 05, 2004 at 20:41:17 (EDT)
Mr. Stein, I send you an email. It has the animation attached for
the DRAGON ANIMATION CONTEST.
amy 9 401
Forrest Hills, NY USA - Wednesday, May 05, 2004 at 17:21:19 (EDT)
Dear Mrs. Bodentein I would like free time in the yard. Happy Mother's
Day!
Teresa 8 303 Ps 101q
NY, NY USA - Wednesday, May 05, 2004 at 16:48:06 (EDT)
Dear Mrs. Bodenstien I would like to spend our period of free time
outside in the school yard
Kats T., 8, 303
Queens, NY USA - Wednesday, May 05, 2004 at 15:14:13 (EDT)
Dear Mrs. Bodenstein, I learned that the Blackbirch tree,when you
take the bark off it,if you put in the freezer then you can make root beer.I
also thought that the black snake was cool.
Jean L.,8,303
Forest Hills, NY USA - Tuesday, May 04, 2004 at 20:43:53 (EDT)
Dear Mrs.Bodenstain, Today,we hiking in the tree ,and we learned
some Natural about hiking.And we learned about the snake hibrnate.
Michael w. 8 years 3-303 p.s.101Q
USA - Tuesday, May 04, 2004 at 19:26:52 (EDT)
Dear Mrs.Bodenstain, I learned about the tree that is mend. And
the other thing is about the earthquake that is the other tree.And the
other thing is about the turtle pond
Michael w. 8years 3-303 p.s.101Q
USA - Tuesday, May 04, 2004 at 18:54:26 (EDT)
Dear Mrs Bodenstein, today my class and I went to Camp Pouch. I
liked hiking the best, becauseit was fun to learn about the different things
about nature. I love nature!
Teresa 8 303 P.S.101Q
USA - Tuesday, May 04, 2004 at 16:55:52 (EDT)
Today my class and I went to Camp Pouch. I liked hiking the best,
becauseit was fun to learn about the different things about nature. I love
nature!
Teresa 8 303 P.S.101Q
USA - Tuesday, May 04, 2004 at 16:55:04 (EDT)
I like this site because it is funny to me and my class
vurdell 11 454 ps 81 @ p4
NYC, NY USA - Tuesday, May 04, 2004 at 15:13:42 (EDT)
We won thy book from thy umbrella. I learned to speak english yesterday!
Drambina Telloaski
Opinotiopia, PK China - Tuesday, May 04, 2004 at 13:19:28 (EDT)
MESSAGE FROM MR. STEIN TO: Andrew 9 301- Yes I will post your dragon
animation to the school website.*** TO: justin 7 ps101- You are correct.
Mr. Gelber's last word in the poem is year. Do you know how many days there
are in each month?** TO:Michaela,10- You have an animation contest. Make
one and email it to me for posting to the Internet**
Mr. Stein
USA - Tuesday, May 04, 2004 at 06:04:53 (EDT)
Mr.Stein, my student number is 3104, can you put it on the dragon
animation for the contest I send you?
Andrew 9 301
- Monday, May 03, 2004 at 21:20:04 (EDT)
hi mr. stein the last word is year
justin 7 ps101
USA - Monday, May 03, 2004 at 20:55:02 (EDT)
I learned that frogs live near a pond.
mikhael 7 201 ps101
New york city, ny USA - Monday, May 03, 2004 at 17:04:13 (EDT)
Do you have any contests for 4th grade?
Michaela,10,401,P.S101-Q
Forrest Hills , ny USA - Monday, May 03, 2004 at 15:15:13 (EDT)
YEA!!! i won the 3-D glasses!! and i hope i win the shell game contest
Jonette Jeter
Jamaica, Ny USA - Sunday, May 02, 2004 at 21:37:16 (EDT)
HI I THINK YOUR WEBSITE IS SO COOL AND MY FRIEND THAT GOES THERE
TELLS MY IT IS GREAT. BYE
PIP 8 210 DAYTON AVE SCHOOL
MANORVILLE, NY USA - Sunday, May 02, 2004 at 18:56:36 (EDT)
hey ps 101 i miss this school so much and russell sage isn't as
fun as this school
Jenifer 12 JHS 190 Sage
NY USA - Sunday, May 02, 2004 at 15:07:59 (EDT)
sorry mr. gelber i didnt see the note that u wrote to me 30 days
has passed september april june and november all the rest have 31 exept
for febuary whitch has 28 and 29 days
justin 7 204 ps101
USA - Sunday, May 02, 2004 at 15:06:47 (EDT)
First, I'm going to score, a computer class. Then, there's tennis.
I'm eating breakfast, now! I just played gameboy.
Sam,9,303
USA - Sunday, May 02, 2004 at 08:39:01 (EDT)
MESSAGES FROM MR. STEIN..... JONETTE WINS A PAIR OF 3D GLASSES FOR
ANSWERING MY QUESTION BELOW!!!! CONGRATS! KATHY: TO ANSWER YOUR QUESTION....
I AM GOING TO SLEEP NOW! BUT FIRST I MUST READ ONE OF THOSE BEDTIME STORIES..
GOOD NIGHT
MR. STEIN
USA - Saturday, May 01, 2004 at 23:16:01 (EDT)
Mr.STEIN: What are you doing now? I'm fine. What time are you going
to sleep? is my story good?
kathy 5 k-013
USA - Saturday, May 01, 2004 at 22:25:07 (EDT)
I know the last word mr gelber said!! it's YEAR for LEAP YEAR!!!
do i win the 3-d glasses?
Jonette Jeter
Jamaica, NY USA - Saturday, May 01, 2004 at 17:26:17 (EDT)
Hello Ms. Fiden, the Nile River runs through Egypt, Sudan, Kenya
and Ethiopia.
Christy
Forest Hills, NY USA - Saturday, May 01, 2004 at 11:05:55 (EDT)
MESSAGE TO VANSH*** PLEASE EMAIL YOUR ANIMATION TO *** emaginatorium@aol.com
*** I am proud of you. I hope you win!!!!
Mr. STEIN
USA - Saturday, May 01, 2004 at 10:45:18 (EDT)
mr stein i made an pin wheel animation but i forgot ur email can
u give it to me agian thanx
vansh,11,602,p.s.101
new york, ny USA - Saturday, May 01, 2004 at 10:24:22 (EDT)
FROM MR. STEIN******* WIN A PAIR OF 3D GLASSES**** TEACHERS INCLUDED****
WHAT IS THE LAST WORD MR/ GELBER SAYS IN HIS VIDEO POEM THAT TELLS THE
NUMBER OF DAYS IN EACH MONTH?????? TO SEE THE VIDEO GO TO OUR MAIN WEBSITE
PAGE AND CLICK ON MR. GELBER. IT IS UNDER THE DINOSAUR. ******* SEE YOU
ALL MONDAY!!!!
Mr. STEIN
USA - Saturday, May 01, 2004 at 09:58:48 (EDT)
Tim wants to go to legoland.com. The internet on my computer finally
came back! Now, I can type!
Sam,9,303
USA - Saturday, May 01, 2004 at 08:44:11 (EDT)
Dear Ms.fiden I found Nile River in Africa
Joey 8 2-202 ps101
USA - Friday, April 30, 2004 at 17:53:55 (EDT)
HEY EVERYONE. MR. Gelber is on the website teaching the number of
days in each month. Find the link under the dinosaur... :)
Mr. Stein
USA - Thursday, April 29, 2004 at 22:50:17 (EDT)
Justin, Terrific! Let's see if you can memorize the poem and repeat
it to me on Friday.
Mr Gelber, 204 ps101
USA - Thursday, April 29, 2004 at 22:24:40 (EDT)
Dear Ms. Fiden, The Nile River runs through Egypt, Sudan, Kenya
and Ethiopia.
Isabella, 7, 202, PS101
USA - Thursday, April 29, 2004 at 20:53:20 (EDT)
Dear Ms.Fiden I found Lake Superior in Canada.
Joey 8 2-202 ps101
USA - Thursday, April 29, 2004 at 19:59:46 (EDT)
dear ms.fiden,I can't find messages.
maria 8 202
ny USA - Thursday, April 29, 2004 at 17:30:07 (EDT)
I wrote you a beadtime story.
jacklyn 7 202
USA - Thursday, April 29, 2004 at 16:57:28 (EDT)
The Nile River go through Egypt.
Moe 8 202 ps101
USA - Thursday, April 29, 2004 at 16:00:40 (EDT)
Dear MR. Stein i figured out the answer it is 30 days has passed
Sectember April June and November all the rest have 31 exept for February
whitch has 28 and 29 days
justin 7 204 ps101
USA - Thursday, April 29, 2004 at 15:19:20 (EDT)
Dear Ms. Fiden, The Nile River runs through Egypt, Sudan, Albert,
Blue, Mountain, Victoria and White.
Anna Maria 7 2-202 ps101
USA - Thursday, April 29, 2004 at 15:10:08 (EDT)
make friendship certeficates please!!!!!!!!!! i like computer class
michaela 10 401 ps101
USA - Thursday, April 29, 2004 at 13:57:34 (EDT)
Dear Class 2-202, Congratulations to Bianca for finding all those
lakes. Keep up the good work!! Love, Mrs. Fiden
Mrs. Fiden
NY USA - Wednesday, April 28, 2004 at 22:43:46 (EDT)
Dear Class 2-202, Congratulations to Bianca for finding all those
lakes. Keep up the good work!! Love, Mrs Fiden
Mrs. Fiden
Ny USA - Wednesday, April 28, 2004 at 22:40:38 (EDT)
Hello Class 2-202, First of all I want to congratulate Christy for
getting the correct answer to the word problem.Now for the rest of the
class - Name all of the countries that the Nile River runs through. Good
Luck!!!
Mrs. Fiden
NY USA - Wednesday, April 28, 2004 at 22:36:45 (EDT)
Dear Mrs.Bodenstein,There are 189,190,191,192 or 194 countries.
Jean L.,8,303
Forest Hills, NY USA - Wednesday, April 28, 2004 at 21:07:17 (EDT)
Dear Mrs.Bodenstein,There are 189,190,191,192 or 194 countries.
Jean L.,8,303
Forest Hills, N USA - Wednesday, April 28, 2004 at 21:07:06 (EDT)
Mr. stein the push me button is funny.
Jordan 9 301
USA - Wednesday, April 28, 2004 at 20:51:47 (EDT)
When am I going to get my crystal egg?
Colleen 8 204 ps101
USA - Wednesday, April 28, 2004 at 20:19:47 (EDT)
Dear Miss Bodenstein or Mr. Stein, There are 189,191,192,193,or
194 countries on the Earth. But I think that the answer right now is 194
countries.
Julia,9,303
USA - Wednesday, April 28, 2004 at 20:15:30 (EDT)
Scott - It looks like you won. Pick one answer please next time.
Kats - Why are you bored?
Mrs. Bodenstein 303
USA - Wednesday, April 28, 2004 at 20:04:37 (EDT)
my brother and i were playing and he kild me THE END i saw a wolf
and he ate my brother i siad'yahoo' the end
shelby 8 302
forest hills, ny USA - Wednesday, April 28, 2004 at 19:55:30 (EDT)
There are 189 190 191 192 or 194 countries in the world
Scott W 8 303
USA - Wednesday, April 28, 2004 at 19:42:51 (EDT)
Mr Stein, I watched this (quicktime) movie on the web with my dad,
we think it should be on your website. http://personal.cet.ac.il/rois/abc-small.mov
love isabelle.
isabelle lee, ps101, k-012
forest hills, NY USA - Wednesday, April 28, 2004 at 19:38:02 (EDT)
Do you like my messages .LOVE. hihihi.
Julia B. 5 k013
USA - Wednesday, April 28, 2004 at 18:31:51 (EDT)
I saw you *KISS* Miss Betty !!! *LOVE*!!!!!!! YOU ARE GETTING *MARRIED*
!!!!!!!!!!!!!! ***OOOOOOOOH!!!*** :0-"OOOOH!"
Julia B. 5 K013
Forest Hills, NY USA - Wednesday, April 28, 2004 at 18:18:05 (EDT)
I saw you *KISS* Miss Betty !!! *LOVE*!!!!!!! YOU ARE GETTING *MARRIED*
!!!!!!!!!!!!!! ***OOOOOOOOH!!!*** :0-"OOOOH!"
Julia B. 5 K013
Forest Hills, NY USA - Wednesday, April 28, 2004 at 18:17:57 (EDT)
I saw you *KISS* Miss Betty !!! *LOVE*!!!!!!!!!!!! YOU ARE GETTING
*MARRIED* !!!!!!!!!!!!!! ***OOOOOOOOOOOOOH!!!*** :0-"OOOOH!"
Julia B. 5 K013
Forest Hills, NY USA - Wednesday, April 28, 2004 at 18:17:39 (EDT)
I saw you *KISS* Miss Betty !!! *LOVE*!!!!!!!!!!!! YOU ARE GETTING
*MARRIED* !!!!!!!!!!!!!! ***OOOOOOOOOOOOOOOOOOOH!!!*** :0-"OOOOH!"
Julia B. 5 K013
Forest Hills, NY USA - Wednesday, April 28, 2004 at 18:17:13 (EDT)
I saw you *KISS* Miss Betty !!! *LOVE*!!!!!!!!!!!! YOU ARE GETTING
*MARRIED* !!!!!!!!! ***OOOOOOOOOOOOOOOOOOOH!!!*** :0-"OOOOH!"
Julia B. 5 K013
Forest Hills, NY USA - Wednesday, April 28, 2004 at 18:16:43 (EDT)
Mr. stien I am bored.
Kats T., 8, 303
ny, ny USA - Wednesday, April 28, 2004 at 17:05:43 (EDT)
mr stein i sent you a animation to your email its thuang28
Chris L.
New York City, NY USA - Wednesday, April 28, 2004 at 14:35:14 (EDT)
i think your website is cool
ps54 401
oueens, ny USA - Wednesday, April 28, 2004 at 13:57:28 (EDT)
hi
bart class606 ps56
queens, Ny USA - Wednesday, April 28, 2004 at 13:53:25 (EDT)
Hello, everyone. Please refer to me as Z. Aleksandra just said,"Pia,
I think yours printed." Something from the printer. THE GULF OF MEXICO,
it says.
Z (Shunella) 502 Age 10 P.S.101Q
Forest Hills, NY USA - Wednesday, April 28, 2004 at 10:23:07 (EDT)
Dear Samantha, Deniz, Claudia and Elijah, Great work!
Mr. Gelber, 204, ps101
USA - Tuesday, April 27, 2004 at 21:19:54 (EDT)
The Three Little Piggies Once upon a time there were three little
piggies. One little piggy made a house of straw, one little piggy made
his house of sticks, one little piggy made his house of bricks. One day
a big bad wolf came and blew the piggy's straw house down and then that
piggy ran to his brother's house made of sticks. Then the big bad wolf
came and blew the stick house down. The two piggies ran together to their
brother's brick house. The wolf came to the brick house and huffed and
puffed and tried to blow the brick house down but he could not. The wolf
decided since he could not blow the house down he would go down the chimney.
The three little piggies made a big, hot, boiling pot of water in the fireplace.
When the big bad wolf came down the chimney he did not see the pot of boiling
water and he fell in it. The three little piggies had wolf stew for dinner
and lived happily ever after.
Chloe, 5, Sawicki Class K-012, PS 101
Forest Hills, NY USA - Tuesday, April 27, 2004 at 20:39:55 (EDT)
Dear Ms.Fiden<3, These are the lakes that I have found so far
: 1-Lake Tahoe 2-Lake Van 3-Lake Zurich 4-Lake Vanern 5-Lake Muritz 6-Lake
Ontario P.S. You are the best teacher, I love you <3
Bianca 8 2-202
USA - Tuesday, April 27, 2004 at 19:58:29 (EDT)
Dear Mrs.Fiden
Bianca 8 2-202 PS101
USA - Tuesday, April 27, 2004 at 19:53:04 (EDT)
Dear Mrs.Fiden
Bianca 8 2-202 PS101
USA - Tuesday, April 27, 2004 at 19:53:02 (EDT)
Dear Mrs.Fiden
Bianca 8 2-202 PS101
USA - Tuesday, April 27, 2004 at 19:53:00 (EDT)
Dear Mrs.Fiden
Bianca 8 2-202 PS101
USA - Tuesday, April 27, 2004 at 19:53:00 (EDT)
Dear Mrs.Bodenstin,last time,it is your birthday.I'm thankyou let
us know your birthday,I also thankyou for let us eat the food.
Michael w. 8 3-303 p.s.101Q
USA - Tuesday, April 27, 2004 at 18:36:47 (EDT)
Dear Mrs. Bodenstein,If I had to leave my home because of war I
would bring these five things: medicine,food,a warm blanket,a brush,and
a picture of my family. Sincerely,Julia
Julia,8,303
NY, USA - Tuesday, April 27, 2004 at 17:48:06 (EDT)
Dear Mrs.Bodenstin,I have 5 things to bring to school.I will bring:my
computer,medicine,food,money,and shirt.
Michael w. 8 p.s.101Q 3-303
USA - Tuesday, April 27, 2004 at 17:13:32 (EDT)
Dear Mrs.Bodenstein, if there was a war, and I had to move I would
bring these five things: 1. medicine so you have a cure if you get sick
2. my diary 3. a stuffed animal to keep you busy so you woud not get lonely
4. money because you might get hungry when you travel 5. my clothes to
keep warm.
Teresa H. 8 years Class 303 P.S.101Q
USA - Tuesday, April 27, 2004 at 16:32:25 (EDT)
If there was a war, and I had to move I wound bring these five things:
1. my glasses to see where youare going 2. my diary 3. a stuffed animal
to keep you busy so you woud not get lonely 4. money because you might
get hungry when you travel 5. my clothes to keep warm.
Teresa H. 8 years Class 303 P.S.101Q
USA - Tuesday, April 27, 2004 at 16:29:40 (EDT)
i will tell you zac the rat
alisa 6 k-012.
USA - Tuesday, April 27, 2004 at 12:49:54 (EDT)
i love you Stein.
chloe 5 k-o12.
USA - Tuesday, April 27, 2004 at 12:43:05 (EDT)
If I had to leave home I bring1;apicterof my family2;mypillow3;medicine4;my
music5;my letters
Paula,9,303 ps101
USA - Tuesday, April 27, 2004 at 11:36:46 (EDT)
Reiko, Sam, and Jean - I'm glad you responded. Let's see who else
answers and a winner (or winners) will be chosen tomorrow. Mrs. B
Mrs. Bodenstein 303
USA - Tuesday, April 27, 2004 at 06:48:41 (EDT)
Ms. Fiden, the answer is 5 days.
Christy
Forest Hills, NY USA - Monday, April 26, 2004 at 22:00:39 (EDT)
Dear Class 2-202, I was very happy to see responses from Maya, Ariel,
Moe, Gabe and Isabella.Good Job!! Love, Ms.Fiden
Ms. Fiden
NY USA - Monday, April 26, 2004 at 21:54:21 (EDT)
Dear Ms. Fiden, The answer to the problem is it will last for 5
days.
Isabella, 7, 202, PS 101
Forest Hills, NY USA - Monday, April 26, 2004 at 20:02:40 (EDT)
Dear Ms. Fiden, The answer to the problem is it will last for 5
days.
Isabella, 7, 202, PS 101
Forest Hills, NY USA - Monday, April 26, 2004 at 20:01:35 (EDT)
Dear Mrs. Fiden, The answer to the problem is the dog food will
last for 5 days.
Gabriel K. 7 2-202 P.S.101
New York City, NY USA - Monday, April 26, 2004 at 19:10:10 (EDT)
The answer is 5 days in the Math problem.
MOE , 8, 202 , ps101
USA - Monday, April 26, 2004 at 17:58:29 (EDT)
The answer to the problem is the food will last for 5 days.
Ariel 7 202 ps 101
USA - Monday, April 26, 2004 at 17:51:26 (EDT)
The answer to the question is 5 days. The food will last for 5 days.
Maya 8 202ps101q
USA - Monday, April 26, 2004 at 16:40:17 (EDT)
Dear Mr.Gelber, The adult Blue Whale is 400,000.
Samantha204101
USA - Monday, April 26, 2004 at 14:12:33 (EDT)
Dear Mr. Gelber, The biggest whale is the blue whale
deniz 8, 204
USA - Monday, April 26, 2004 at 14:07:39 (EDT)
Dear MrGelber, A adult whale is as big as three buses.
Claudia 7 204
USA - Monday, April 26, 2004 at 13:46:52 (EDT)
Dear Mr. Gelber, The big blue whale can weigh more than 4000,000
pounds.
Alexander,7 , 204
USA - Monday, April 26, 2004 at 13:09:19 (EDT)
Dear Mr. Gelber, The big blue whale can weigh more than 4000,000
pounds.
Alexander,7 , 204
USA - Monday, April 26, 2004 at 13:08:08 (EDT)
Dear Mr. Gelber,
A
lex, USA - Monday, April 26, 2004 at 13:01:37 (EDT)
Dear Mr. Gelber,
A
lex, USA - Monday, April 26, 2004 at 13:01:37 (EDT)
Dear Mr. Gelber,
A
lex, USA - Monday, April 26, 2004 at 13:01:36 (EDT)
Hello MR.Stein
Baruh 10 119 p.s.101q
NEW YORK, N.Y RUSSIA - Monday, April 26, 2004 at 11:18:35 (EDT)
Hello MR.Stein
Baruh 10 119 p.s.101q
NEW YORK, N.Y RUSSIA - Monday, April 26, 2004 at 11:18:34 (EDT)
Hello MR.Stein
Baruh 10 119 p.s.101q
NEW YORK, N.Y RUSSIA - Monday, April 26, 2004 at 11:18:34 (EDT)
Hello MR.Stein
Baruh 10 119 p.s.101q
NEW YORK, N.Y RUSSIA - Monday, April 26, 2004 at 11:18:33 (EDT)
Hello MR.Stein.
Baruh 10 119 p.s.101q
NEW YORK, N.Y RUSSIA - Monday, April 26, 2004 at 11:17:31 (EDT)
Dear Mr GELBER, Whales can way more than 2000,000 pouds.
Alexander 7 p.s.101
USA - Monday, April 26, 2004 at 11:13:17 (EDT)
Dear Mr GELBER, Whales can way more than 2000,000 pouds.
Alexander 7 p.s.101
USA - Monday, April 26, 2004 at 11:11:55 (EDT)
Dear Mrs. Bodenstein, Reiko+ Sam- We would bring the following if
we were to leave our home because of war. 1. Clothing 2. Favorite toys
3. Sleeping bags 4. Our diaries S5. Sam's gameboy R5. lots of books to
read
Samantha + Reiko, 303, 9-9
USA - Monday, April 26, 2004 at 11:08:50 (EDT)
Dear Mr.Gelber, why are whales so big?
Alexander 7 P.S.101
USA - Monday, April 26, 2004 at 10:49:35 (EDT)
Dear Ms. Bodenstein, If I had to leave my home because of war I
would bring these 5 things: 1. my stuffed animals, water, computer, food,
medicine.
Jean 303 8
USA - Monday, April 26, 2004 at 10:45:48 (EDT)
The blue whale is the biggest animal.
Sakura,7,204,ps101
USA - Monday, April 26, 2004 at 10:11:11 (EDT)
Dear Mr.Gelber An adult whale can grow as long as three school buses.
Igor 8 204 ps101
USA - Monday, April 26, 2004 at 09:51:57 (EDT)
Blue whales have been sighted in all of the earth's oceans.
Elijah 8 ps101 204
USA - Monday, April 26, 2004 at 09:29:35 (EDT)
HEY mr stein i really like the bed time story i play with it with
my little baby sister alaysia clarke she is two years old and she enjoy
it thank you
Cecile 11 501 ps101
ny, queensjamaica USA - Sunday, April 25, 2004 at 19:01:54 (EDT)
Dear Jonette, I am sorry you are going to move to CT. Perhaps you
will stay in touch by using the guest book. :(
Mr. Stein
USA - Saturday, April 24, 2004 at 16:17:33 (EDT)
Hello 2 JABIR!! hi hi everybody! i wish i wasn't moving 2 CT
Jonette Jeter 12 601
Jamaica, NY USA - Saturday, April 24, 2004 at 16:09:49 (EDT)
Dear Class 2-202, Christy-I enjoyed reading your response about
sharks. Here is the problem for the weekend. Maya buys a 10-pound bag of
dog food. Her dog eats 2 pounds of food a day. For how many days will the
bag of food last? Anyone who gets the correct answer will get a treat on
Monday. GOOD LUCK!! Enjoy the rest of the weekend!! Love, Mrs. Fiden
Mrs. Fiden
NY USA - Saturday, April 24, 2004 at 10:05:03 (EDT)
MESSAGE TO krishen, 6, k013. GOOD NEWS.... GO TO THE CHICKEN ON
OUR WEBSITE. UNDER THE CHICKEN IT SAYS WINNERS. CLICK IT TO SEE WHO WON
THE TELL MR. STEIN A BEDTIME STORY.**** SEE YOU SOON!!!!
MR. STEIN
USA - Saturday, April 24, 2004 at 07:12:29 (EDT)
***MESSAGE FROM MR. STEIN*** TO krishen, 6, k013. THANK YOU FOR
YOUR MESSAGE. CAN YOU TAKE A PICTUE OF YOU AND YOUR GRANDMOTHER. WE CAN
PUT IT UP ON THE U.S. MAP IN THE HALL. WE WILL DRAW A LINE FROM THE PICTURE
TO WHERE YOU ARE LOCATED ON THE U.S. MAP. WE MISS YOU. :)
Mr. Stein
USA - Saturday, April 24, 2004 at 07:08:49 (EDT)
you gagagagagugugagagugugagagagagaagagaggaqgagagagugugugug
omi //??????????????????????????????????????????????????
USA - Friday, April 23, 2004 at 21:22:50 (EDT)
++ +x-+t-x+t+x++t+x+t+x++t+x+t++x+t+x+t+x++t+x+t+x++t+x++t+x+txtxtxtxtxtdxtxtxtxxxtxtxtxtxtxtxtxxtxtxtxtxttxt------//ueracudsgcetcyedsjyedttrextxtxtxtxtxtxtxtxtxtxtxtxtxxttxtxtxtxtxtxhcfjkgvwrkajujhyhyhhyyhh7uhuhuhuhu58h5uh/u585h/*85845/84
8*58*58*5*8589548/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*8/*56/
hghghg
USA - Friday, April 23, 2004 at 21:21:16 (EDT)
hi uiurtctrfyertfjyerufiyeuyfr7eywuftuittfyuetiurftetfet7ufteuwriftuietfuiewttfteftewtfuiewtuqftuwteuftqtfiutiwtqfititffewtfi2teugfqgrfeui6fe4treq5lfyuet,-uwr0oy-iudwr,eywtiu,-oykt,d-ok-okeudw,-odr9rkdosiuw45,0iudsi,0uwq,di65ouaks,tok,jsau48m
tdsry4kdu58myad4ti0ymdtiysa4ysaysaxt,xt,xt,xt,xt,xt,xt,xt,msa459diymqr9dit0yratatatatatatatatatatatatatatatatatatatatatatateyms0er0ewqmarmarmarmarmarmarmarmarmarlf,qrfiyu,9iy,upou,--foyiu,fy9i
arya 8
USA - Friday, April 23, 2004 at 21:19:20 (EDT)
vxgdgfcvfthh nouhbdgheydsgbe9ur8geourng udr8ngfu8enr7yfhne yuenrgynerg8nf9u8ng9uf8n
u8nudnf9usj k9imhf9ungjdi
ghghgh
USA - Friday, April 23, 2004 at 21:00:07 (EDT)
I learned that sharks can live very long. They can live up to 50
years. I also found out that they do not lay eggs. Tiger sharks have stripes
and that is how they got their name.
Christy W, 8, 2-202, PS101
Forest Hills, NY USA - Friday, April 23, 2004 at 20:46:36 (EDT)
you i,ill dont like my face
omi 303
USA - Friday, April 23, 2004 at 20:06:43 (EDT)
hahahahhhahahahahaha
omi
USA - Friday, April 23, 2004 at 20:03:44 (EDT)
dear anna maria (my daughter) is it really true that sharks do not
lay eggs??? i never knew that love u lots miss u bunches daddy xxx
dale hardcastle
london, UK - Friday, April 23, 2004 at 15:01:15 (EDT)
hello mr. stein, i am in florida today. i am here to see my grandmother
for her birthday. she is 77 years old today. my grandmother lives in indian
rocks beach on the gulf of mexico. please say hello to michael v., leon,
toma and julia b. i will not be in your computer class today. see you next
week. good bye.
krishen, 6, k013, ps101
nyc, ny USA - Friday, April 23, 2004 at 07:43:33 (EDT)
Dear Class 2-202, I was so happy to see responses from Isabella,Joey,Ariel,Anna
Maria,Maria and Maya. I hope to get responses from more children next time.
Have a great weekend!! :) Love, Mrs. Fiden
Mrs. Fiden
NY USA - Thursday, April 22, 2004 at 22:12:20 (EDT)
6th Graders: Go to any of the links on the following page: http://www.internet4classrooms.com/skills_6th.htm
, print out the page, complete it, and hand it in to your Math teacher
with your results by MONDAY, APRIL 26th and RECEIVE EXTRA CREDIT IN YOUR
MATH GROUP. THIS IS HOW IT WORKS: The more you do, the more EXTRA CREDIT
you will receive. Complete 5 online pages of any topic that we covered
this year (must have at least 10 problems per page) and get ONE NO-HOMEWORK
PASS for any day of your choice for the remainder of the school year (plus
the extra credit that you deserve towards your last report card). The goal
here is simple. Using the online test-prep pages, you not only review for
Tuesday's Citywide Exam, but you can receive extra credit on your report
card at the same time. For those of you who need a little extra practice,
this is a great way to get it. GOOD LUCK and remember to STUDY for Tuesday's
Test this weekend! With a smile, Mr. H
Mr. Hyman, Class 601
Forest Hills, NY USA - Thursday, April 22, 2004 at 21:25:41 (EDT)
Kayla, Yes. I like all my students! The boys and girls in our class
are the nicest children I've ever known!
Mr. Gelber teacher 204
USA - Thursday, April 22, 2004 at 21:12:32 (EDT)
Class 204, I'm so proud of Hannah, Kayla, Colleen, Claudia and Eric
for sending in their answers.
Mr. Gelber teacher 204
USA - Thursday, April 22, 2004 at 21:07:39 (EDT)
i predicted my mom would like the dog and she did. i predicted my
dad would like the cheetah and he did.
sabrina 7 201
USA - Thursday, April 22, 2004 at 20:53:38 (EDT)
I learned that sharks do not lay eggs, they give birth to live young.
Anna Maria 7 2-202 ps101
USA - Thursday, April 22, 2004 at 20:38:04 (EDT)
dear ms.fiden,most shrarks are not dangerous.
maria 7 202
ny USA - Thursday, April 22, 2004 at 20:20:32 (EDT)
dear ms.fiden, most sharks are no more dangerous.
maria 7 202
ny USA - Thursday, April 22, 2004 at 20:18:42 (EDT)
i was right my mom likes the dog.
Isabella, 7, 202, PS 101
Forest Hills, NY USA - Thursday, April 22, 2004 at 20:18:19 (EDT)
most sharks are no more dangerous.
maria 7 202
ny USA - Thursday, April 22, 2004 at 20:17:14 (EDT)
Dear Ms. Fiden, Tiger sharks do not lay eggs, they give birth to
live young. Love, Isabella
Isabella, 7, 202, PS 101
Forest Hills, NY USA - Thursday, April 22, 2004 at 20:14:52 (EDT)
Dear Ms. Fiden, Tiger sharks do not lay eggs they give birth to
live young. Love, Isabella
Isabella, 7, 202, PS 101
Forest Hills, NY USA - Thursday, April 22, 2004 at 20:12:08 (EDT)
Dear Ms.Fiden There are 340 speicies of sharks
Joey 8 2-202 ps101
USA - Thursday, April 22, 2004 at 18:09:34 (EDT)
Dear Mrs.Fiden, I learned that sharks originaated some 450 millions
years ago.Most sharks never attack people.Sharks eat fish,turttes,birds,and
clams.
Ariel 7 2o2 ps1o1
USA - Thursday, April 22, 2004 at 17:27:58 (EDT)
Dear Ms. Steincke, Only kdding about Kindergarten. The Blue whale
is the largest animal.
Mr. Stein K-011 6 PS101
USA - Thursday, April 22, 2004 at 16:55:38 (EDT)
Dear Andrew, YOU WON THE LOLIPOP!!!! Congratulations!
Mrs. Steincke
Forest Hills, N.Y. USA - Thursday, April 22, 2004 at 16:01:04 (EDT)
Dear Ms Steincke the answer is Four
Andrew7 203 ps101
Forest Hills, NY USA - Thursday, April 22, 2004 at 15:25:03 (EDT)
The cheetah be phat.
Colon Elio, 14, Grady High School
Brooklyn, NY USA - Thursday, April 22, 2004 at 14:27:16 (EDT)
dear mr. gellber ilike
kayla 7 204
USA - Thursday, April 22, 2004 at 14:26:49 (EDT)
I like you do you like me
kayla 7 204
USA - Thursday, April 22, 2004 at 14:20:40 (EDT)
I like you do you like me
kayla 7 204
USA - Thursday, April 22, 2004 at 14:18:44 (EDT)
Dear Mr. Gelber, Large whales are safe from most predators.
Colleen 8 204 ps101
USA - Thursday, April 22, 2004 at 14:16:27 (EDT)
The whale is realy realy big.
Claudia 7 204
USA - Thursday, April 22, 2004 at 14:16:25 (EDT)
the tigershark is the larges
eric 8 204
USA - Thursday, April 22, 2004 at 14:15:18 (EDT)
I'm proud of Hannah.
mr. gelber teacher 204
USA - Thursday, April 22, 2004 at 14:14:35 (EDT)
Blue whales are as big as 24 elephants.
Johnny 7 204 ps101
USA - Thursday, April 22, 2004 at 14:12:26 (EDT)
Dear Mr. Gelber, The blue whale is the biggest whale.
Hannah 7 204 ps101
USA - Thursday, April 22, 2004 at 14:03:55 (EDT)
I predict my mom will like the world.
Yakubmier 6
USA - Thursday, April 22, 2004 at 12:56:13 (EDT)
I predict my mom is going to like the world
lala 7 102 ps101
USA - Thursday, April 22, 2004 at 12:55:29 (EDT)
We predict our brothers will like the word.
Claire and Nicole 102 ps101
USA - Thursday, April 22, 2004 at 12:54:38 (EDT)
i predict my mom will like the dog.
shira6 102 ps101
USA - Thursday, April 22, 2004 at 12:52:42 (EDT)
i predict that my brother will like the dog.
Abigail 6 102
USA - Thursday, April 22, 2004 at 12:51:33 (EDT)
I predict that my dad would like the eagle
Borja 7 102 ps101
USA - Thursday, April 22, 2004 at 12:49:39 (EDT)
i perdict my mom would like the cheetah.
MELISSA 6 102 PS101
USA - Thursday, April 22, 2004 at 12:49:36 (EDT)
I think my dad is going to like the world.
Daniel Z. 6 102 ps101
USA - Thursday, April 22, 2004 at 12:48:50 (EDT)
Dear Mr.Stein, I predict my dad likes the dog. Love,Justin
Justin 6 102 P.S.101
USA - Thursday, April 22, 2004 at 12:47:24 (EDT)
I think my mom would like the dog.
jAELAH 7 102 ps101
USA - Thursday, April 22, 2004 at 12:46:29 (EDT)
my mom is goneu like it
lala 6 102 ps101
USA - Thursday, April 22, 2004 at 12:41:29 (EDT)
I predict my dad would like the world.
David 7 ps101
USA - Thursday, April 22, 2004 at 12:41:11 (EDT)
i predict that my dad will like the world.
david 7 102 ps101
USA - Thursday, April 22, 2004 at 12:33:45 (EDT)
I PREDICT that my mom will like the world.
Lala 6 102 ps101
USA - Thursday, April 22, 2004 at 12:24:55 (EDT)
Dear Class 203, Win a lollipop. Be the first to answer this question
and write it on the Guestbook. How much is 2 + 2?
steincke teacher 203
USA - Thursday, April 22, 2004 at 11:33:06 (EDT)
The blue whale is blue.
Mrs.Steincke Teacher 203
USA - Thursday, April 22, 2004 at 11:26:25 (EDT)
i like the dog.
katherine 6 k014
USA - Thursday, April 22, 2004 at 10:29:04 (EDT)
i like dog
noah 6 ko14
USA - Thursday, April 22, 2004 at 10:28:40 (EDT)
I like the giraffe
Julia 5 k-014
USA - Thursday, April 22, 2004 at 10:18:29 (EDT)
i like cas do you
anoosha 5 ko14
USA - Thursday, April 22, 2004 at 10:17:53 (EDT)
ilikeelelephant
pierre6ko14
USA - Thursday, April 22, 2004 at 10:17:46 (EDT)
I like 3d
Joshua5 k014ps101
NYC, NY USA - Thursday, April 22, 2004 at 10:15:40 (EDT)
I Like The Elethant
DAVID 6 k014
USA - Thursday, April 22, 2004 at 10:15:30 (EDT)
I like the elphint
sunny 6 k-014
USA - Thursday, April 22, 2004 at 10:15:16 (EDT)
i like eagle
reona6ko14
USA - Thursday, April 22, 2004 at 10:15:13 (EDT)
i like the world
jiyung 5 k014 ps101
USA - Thursday, April 22, 2004 at 10:11:52 (EDT)
I LIKE CHEETAH
WENYI 6 KO14
NEW YORK, USA - Thursday, April 22, 2004 at 10:10:55 (EDT)
ilikdg.night
reona6ko14
USA - Thursday, April 22, 2004 at 10:10:53 (EDT)
I like the dog
Alinda 5 k014 ps101
USA - Thursday, April 22, 2004 at 10:04:49 (EDT)
ilike world
jiyung 5 k014
USA - Thursday, April 22, 2004 at 09:59:28 (EDT)
I predict mom wolud like dog...................................
kyra 8 201ps101
USA - Thursday, April 22, 2004 at 09:32:10 (EDT)
dear mrs klien,the tiger shark eats almost enething.
sabrina 7 201 p.s.101
USA - Thursday, April 22, 2004 at 09:31:05 (EDT)
I learned about is tiger sharks are tall.
Amane , 8 , 201 , p.s.101
USA - Thursday, April 22, 2004 at 09:29:24 (EDT)
I think my mom like the eagle.
Eric 8 201
USA - Thursday, April 22, 2004 at 09:29:04 (EDT)
I predict thatdog...........
kyra 8 201ps101
USA - Thursday, April 22, 2004 at 09:28:37 (EDT)
I predict that my mom will like the dog.
Cassandra 7 201 ps101
USA - Thursday, April 22, 2004 at 09:28:18 (EDT)
Ipredict that my mom will like the dog.
melannie 8 201 ps101
USA - Thursday, April 22, 2004 at 09:27:04 (EDT)
Ipridict my mom would like the dog.
jaclyn7201101
USA - Thursday, April 22, 2004 at 09:26:20 (EDT)
I PREDIT my mom will like the elaphant
Granit Lahu Class2-201
Forest Hills, ny USA - Thursday, April 22, 2004 at 09:25:18 (EDT)
I PREDICT my mom will like the DOG!!!!!!!!!!!!!!!!!!!!!!!!!
Daniel 8 201 p.s.101
USA - Thursday, April 22, 2004 at 09:24:59 (EDT)
Dear Ms. Klein, Frogs have 4 legs
Eric 8 201 ps101
USA - Thursday, April 22, 2004 at 09:24:55 (EDT)
I Pridict mom will like the dog.And my dad will like the cheetah.
sabrina 7 201 p.s.101
USA - Thursday, April 22, 2004 at 09:24:14 (EDT)
Ms steinke I learned that whales are the bigest animal in the ocean
that ever lived.
Granit Lahu Class2-201
Forest Hills, ny USA - Thursday, April 22, 2004 at 09:23:36 (EDT)
I think my mom will like the giraffe
Matthew 7 201 ps101
USA - Thursday, April 22, 2004 at 09:21:28 (EDT)
I PREDICT that my Mom will like the eagle.
Valentina 8 201 PS101
USA - Thursday, April 22, 2004 at 09:13:24 (EDT)
Dear Ms. Friden, The tiger shark is one of the largest.
Megan 7 201 ps101
USA - Thursday, April 22, 2004 at 09:10:28 (EDT)
I PREDICT that my mom will like ihe giraffe the best.
Anna Maria 7 2-202 ps101
USA - Thursday, April 22, 2004 at 09:05:31 (EDT)
iwillbuygood
william8 class202 ps101
USA - Thursday, April 22, 2004 at 09:04:47 (EDT)
I predict my dad will like the dog.
Arthur 8 202 P.S.101Q
NY USA - Thursday, April 22, 2004 at 09:04:31 (EDT)
I think that my parents would like the dog to mom and dad
Joey 8 202
USA - Thursday, April 22, 2004 at 09:03:14 (EDT)
DearMs.Fiden, A Tiger Shark is covered with dark spots.
Maya 8 202 ps101q
USA - Thursday, April 22, 2004 at 08:58:08 (EDT)
I can not write you a message at home
Natthinee 9 2'202 PS101Q
USA - Thursday, April 22, 2004 at 08:57:50 (EDT)
Dear Ms. Fiden, Tiger sharks do not lay eggs.
Isabella 202 7 ps101
USA - Thursday, April 22, 2004 at 08:53:40 (EDT)
I PREDICT that my will the dog.
Christy 8 202
ny USA - Thursday, April 22, 2004 at 08:50:25 (EDT)
I am excited about using the guestbook,
Ms. Fiden Teacher 202 ps101
USA - Thursday, April 22, 2004 at 08:50:15 (EDT)
I PERDICT that my mom will like the Dog.
Moe 8 202 ps101
USA - Thursday, April 22, 2004 at 08:50:06 (EDT)
my name is felia my grandpa likes the dog,
felisa ps 101q class202
USA - Thursday, April 22, 2004 at 08:49:39 (EDT)
I PREDICT that my mom will like the girrafe.
Anna Maria 7 2-202 ps101
USA - Thursday, April 22, 2004 at 08:48:44 (EDT)
i predict my mom will like the dog.
isabella 7 202 ps101
USA - Thursday, April 22, 2004 at 08:48:20 (EDT)
I PREDICT that my mom will like the dog.
Maria 8 202
ny USA - Thursday, April 22, 2004 at 08:47:58 (EDT)
I PREDICT that my will like the girrafe.
Anna Maria 7 2-202 ps101
USA - Thursday, April 22, 2004 at 08:46:46 (EDT)
I PRIDICT that my mom will like the dog,
Maya 8 202 ps101q
USA - Thursday, April 22, 2004 at 08:46:04 (EDT)
I PRIDICT that my mom will like the dog,
Maya 8 202 ps101q
USA - Thursday, April 22, 2004 at 08:45:57 (EDT)
I PREDICT that my Mom will like the dog,
Zachary 7 202 PS101
USA - Thursday, April 22, 2004 at 08:34:20 (EDT)
We were right! My cheetah wa correct, and Tim's girff was right,
too! Tim-
Same
USA - Wednesday, April 21, 2004 at 20:23:07 (EDT)
Tim- I think my mom will like the giraffe. Sam-I think it's the
world, or the cheetah. Mostly I've got dibbs on cheetah.
Sam,9,303+Tim,5,ko12 P.s.101Q
USA - Wednesday, April 21, 2004 at 20:20:48 (EDT)
To MS. steincke' whales eat krill
Andrew7 203 101
Forest Hills, NY USA - Wednesday, April 21, 2004 at 20:03:15 (EDT)
my guess was wrong my mom likes the rooster the best not the giraffe
because it is colorful so that why she picked the rooster.
natalie 10 403
USA - Wednesday, April 21, 2004 at 19:51:01 (EDT)
My sister won a crystal egg!I am so proud of her.Can you please
make another contest? 0:-)
Yunfei L.403 10
New York City, NY USA - Wednesday, April 21, 2004 at 18:44:39 (EDT)
Ms.Stienke,In spring and early summer,blue whales migrate from warm
tropical waters to colder regions rich with krill.
Dina 7 203 P.S.101
USA - Wednesday, April 21, 2004 at 15:10:43 (EDT)
888888888888
Patricia ,10, 403
NY, NY USA - Wednesday, April 21, 2004 at 13:45:45 (EDT)
I Predict my mom will like the cheatah
claudia 4 403
USA - Wednesday, April 21, 2004 at 13:41:25 (EDT)
I Predict my mom will like the cheatah
claudia 4 403
USA - Wednesday, April 21, 2004 at 13:41:19 (EDT)
I PREDICT that my mom will like the dog
Rachel 10 403
USA - Wednesday, April 21, 2004 at 13:40:01 (EDT)
iguess my mom will like the giraffe.
Natalie ,10,403
USA - Wednesday, April 21, 2004 at 13:39:57 (EDT)
I think my mom will like the Cheetah.
alena , 9 403
Nyc, NY USA - Wednesday, April 21, 2004 at 13:38:05 (EDT)
I predict my mom will like the cheetah the is best
Boris
USA - Wednesday, April 21, 2004 at 13:37:57 (EDT)
I predict my mom will like the Eagle
Sachit 9 403
USA - Wednesday, April 21, 2004 at 13:36:32 (EDT)
I predict that my mom will like the cheetah best.
Benjamin K. 10 403 P.S.101
New York City, NY USA - Wednesday, April 21, 2004 at 13:35:08 (EDT)
eagle
christopher2-223p.s.205
bayside, ny USA - Wednesday, April 21, 2004 at 13:26:43 (EDT)
elephant
benh2-223p.s.2o5
ny, USA - Wednesday, April 21, 2004 at 13:26:01 (EDT)
My favorite one is the hand holding paint
Judy 8 2-223 P.S.205
Bayside, NY USA - Wednesday, April 21, 2004 at 13:25:51 (EDT)
Eagle
Justin W 9 2223 ps205
USA - Wednesday, April 21, 2004 at 13:25:40 (EDT)
eagle
erin o 2-223 p.s.205
bayside, ny USA - Wednesday, April 21, 2004 at 13:25:31 (EDT)
I loved the cheata .
christina a 7 2-223 ps 205
baside, ny USA - Wednesday, April 21, 2004 at 13:25:11 (EDT)
My favorite is the state.
SandasiC 2-223 7yearsp.s.205
Bayside, n.y USA - Wednesday, April 21, 2004 at 13:25:07 (EDT)
I PREDICT that my mom will like the Eagle.
Evan 10 403
USA - Wednesday, April 21, 2004 at 13:25:07 (EDT)
eagle
nicole m 2-223
bayside , ny USA - Wednesday, April 21, 2004 at 13:24:58 (EDT)
cheetha
Arisa C 8 Class2-223 P.S205
Queens, NY USA - Wednesday, April 21, 2004 at 13:24:42 (EDT)
My favorite is the dog.
Dana W. 7 2-223 P.S.205
Bayside, N.Y USA - Wednesday, April 21, 2004 at 13:24:34 (EDT)
I liked the bird.
Vasia M class 2-223 P.S 205
Bay, NY USA - Wednesday, April 21, 2004 at 13:24:28 (EDT)
my favorite one was the elephant
Amys 2-223P.S.205
bayside, NY USA - Wednesday, April 21, 2004 at 13:24:12 (EDT)
my favorite is eagle
matthew l. 8 2-223 p.s205
bayside, ny USA - Wednesday, April 21, 2004 at 13:23:55 (EDT)
Eagle
Daniel y. 7 2-223 P.S.205
New York City, New York USA - Wednesday, April 21, 2004 at 13:23:47
(EDT)
MY FAVORITE ONE WAS THE DOG
ANTHONY C 2-223 PS205
BAY SIDE, NY USA - Wednesday, April 21, 2004 at 13:23:36 (EDT)
Eagle
Michael M 2-223 7 PS205
New york city, NY USA - Wednesday, April 21, 2004 at 13:23:36 (EDT)
the tiger
rachel w 2-223
bayside ny, ny USA - Wednesday, April 21, 2004 at 13:23:31 (EDT)
THE Tiger
RUSSELL D 2-223
bayside, NY USA - Wednesday, April 21, 2004 at 13:23:28 (EDT)
The bird
heather g 2-223 p.s.205
bayside, ny USA - Wednesday, April 21, 2004 at 13:23:23 (EDT)
THE EAGLE
hannah c. 2-223 p.s.205
bayside, N.Y. USA - Wednesday, April 21, 2004 at 13:22:26 (EDT)
i hope that my boyfriend is not cheating on me. because i love him
very much. i also like eggs. mwah!!
cristy, pre algebra. Yorba linda, 14
orange, Fl USA - Wednesday, April 21, 2004 at 11:58:48 (EDT)
I really think your website is cool
LIssette 11 502 ps54
richmonhill, ny USA - Wednesday, April 21, 2004 at 09:15:07 (EDT)
Mr Stein, I finally got onto the website. I am so excited!!
Ms. Fiden 2-202
Forest Hills, NY USA - Tuesday, April 20, 2004 at 22:21:53 (EDT)
My mom liked the dog
Taro,6,103
Forest Hills, NY USA - Tuesday, April 20, 2004 at 21:15:09 (EDT)
Whales can grow to be as heavy as 24 African elephants. Some have
to eat 40 milllion krill every day! Krill are tiny fish that all whales
eat; no substitution!
Alison, 8, 203, ps101
USA - Tuesday, April 20, 2004 at 20:54:54 (EDT)
I was right my mom did like the dog.
NEIL 6,103 PS101
USA - Tuesday, April 20, 2004 at 20:45:25 (EDT)
i was wong my dad like the elephant
isabella 5 k012
USA - Tuesday, April 20, 2004 at 20:09:40 (EDT)
Mommy's favorite is the giraffe
Waylon Lai, 6, 103, P.S.101
Forest Hills, N.Y. USA - Tuesday, April 20, 2004 at 18:17:08 (EDT)
Your hand paintings are great.My favorite one was the earth.
Dean B. 3-238 P.S.205
Bayside, N.Y. USA - Tuesday, April 20, 2004 at 14:13:17 (EDT)
I like this web site a lot. The dog hand shape was my favorite.
Allison V.D,9,3-238,P.S,205Q
NY, NY USA - Tuesday, April 20, 2004 at 14:12:30 (EDT)
I like the eagle it was wicked!!! Also all are perfect.
M.F 3-238 P.S.205Q
Bayside, NY USA - Tuesday, April 20, 2004 at 14:12:26 (EDT)
I like the website you made. My favrite one is the World. And I
like all of them too.
Michael S. 8 3-238 P.S.205
Bayside, NY USA - Tuesday, April 20, 2004 at 14:12:09 (EDT)
I like the hands that looks like animals.
bianca leroy 3-238 basiyed NY P.S.205
USA - Tuesday, April 20, 2004 at 14:11:37 (EDT)
Ithink the handpaintings are very prety.My favorit isthe dog.
3-238 elvisa
USA - Tuesday, April 20, 2004 at 14:11:19 (EDT)
I loved the hand paintings! My favorite one is the eagle. It looks
so real!
Kiara P. 3-238 P.S.205Q
Bayside, N.Y USA - Tuesday, April 20, 2004 at 14:11:00 (EDT)
I loved the paintings. The paintigs were cool!
Tanvir A. P.S205Q
Baside, NY USA - Tuesday, April 20, 2004 at 14:10:49 (EDT)
I reley like your web site.I reler like the egele haend pating.
jessica m. 3-238 p.s.205
bayside N.Y., USA - Tuesday, April 20, 2004 at 14:10:41 (EDT)
I think the finger paintings. My favoite one is the eagle.
Jeremiah Lee 8 3-238 P.S.205
Bayside, N.Y.State USA - Tuesday, April 20, 2004 at 14:10:34 (EDT)
Ithink the handpaintings are very prety.My favorit isthe dog.
3-238
USA - Tuesday, April 20, 2004 at 14:10:25 (EDT)
The Hand Paintings were cool the cheetah was my favorite.
Matthew Y. 3-328 P.S.205Q Bayside New York
Bayside, N.Y. USA - Tuesday, April 20, 2004 at 14:10:04 (EDT)
I like your pictures. They are cool. I like the picture of the dog.
Ariel Y. 3-238 P.S.205 Q
USA - Tuesday, April 20, 2004 at 14:09:34 (EDT)
I like your pictures. I like the girraffe.
Paris 3-238 P.s.205q
USA - Tuesday, April 20, 2004 at 14:09:33 (EDT)
I think that your hand painting is cool
Carlin 8 3-238 P.S.205
Bayside, USA - Tuesday, April 20, 2004 at 14:09:00 (EDT)
I loved the paintings The paintigs were cool
Tanvir A. P.S205Q
Baside, NY USA - Tuesday, April 20, 2004 at 14:08:45 (EDT)
I really liked the hand paintings.They were really cool.I liked
the dog the most because dogs are my favorite pets.
Melanie C. 3-238 P.S.205
Bayside, N.Y. USA - Tuesday, April 20, 2004 at 14:08:08 (EDT)
I loved the paintings
Tanvir A. P.S205Q
Baside, NY USA - Tuesday, April 20, 2004 at 14:08:06 (EDT)
your hand paintings were really great.my favorite is the cheetah
Sarah W. 3-238 P.S.205
USA - Tuesday, April 20, 2004 at 14:08:05 (EDT)
This website was awesome. I loved the animals the kids did with
their hands! I liked the cheetah very much!
Ryan Y. 3-238 P.S.205Q
Bayside, NY USA - Tuesday, April 20, 2004 at 14:07:58 (EDT)
I really like your hand paintings. My favorite one was the the cheetah.
Zach M 3-238 P.S205q
Bayside, NY USA - Tuesday, April 20, 2004 at 14:07:49 (EDT)
I think that this is a great website for students of all ages.
Stephanie C. 3-238 P.S.205Q 8
NY, NY USA - Tuesday, April 20, 2004 at 14:07:40 (EDT)
I like the eagle it was wicked!!! Also all are perfect
M.F 3-238 P.S.205Q
Bayside, NY USA - Tuesday, April 20, 2004 at 14:07:32 (EDT)
I liked the hand paintings! I thought they were really cool! My
favorite one was the dog. It looked almost real!
Alison F. 3-238 P.S.205
Bayside, NY USA - Tuesday, April 20, 2004 at 14:06:36 (EDT)
Blah Blah Blah
Wilson,12,601,101
Forest Hills, NY USA - Tuesday, April 20, 2004 at 13:51:29 (EDT)
I predict that my mom will like the rooster.
Evalena 6 k-012
USA - Tuesday, April 20, 2004 at 11:08:24 (EDT)
I PREDICt my mom will like the world
igli 6 k-o12
USA - Tuesday, April 20, 2004 at 11:07:11 (EDT)
I Predict my mom will like
Timothy 5 k-012
USA - Tuesday, April 20, 2004 at 11:06:07 (EDT)
eagle
eliza 6 k012
USA - Tuesday, April 20, 2004 at 11:05:48 (EDT)
i predict mom will like dog
christinek'0125
USA - Tuesday, April 20, 2004 at 11:04:25 (EDT)
i predict my mom will like the world
sebastian 6 k-012
USA - Tuesday, April 20, 2004 at 11:04:12 (EDT)
i predict that my mom will like the world
andyp
USA - Tuesday, April 20, 2004 at 10:59:21 (EDT)
i predict my mom will like the dog
christine 5 k012
USA - Tuesday, April 20, 2004 at 10:59:03 (EDT)
i predict that my mom will like dog
michelle5ko2i1
USA - Tuesday, April 20, 2004 at 10:57:40 (EDT)
i predict that my dad will like the dog
isabella 5 k012 ps101
USA - Tuesday, April 20, 2004 at 10:55:56 (EDT)
I PREDICT that my mom will like the giraffe
Timothy 5 k-012
USA - Tuesday, April 20, 2004 at 10:47:45 (EDT)
i preact mom that the like
kamal 6.103
USA - Tuesday, April 20, 2004 at 09:44:33 (EDT)
i think my mom will like the dog.
claribel 6 class103
USA - Tuesday, April 20, 2004 at 09:43:58 (EDT)
MY MOM WILL LIKE THE DOG BECAUSE IT IS CUTE.
NATALIE 6 103 101
USA - Tuesday, April 20, 2004 at 09:37:14 (EDT)
I predict my mom like the dog
taro,103
USA - Tuesday, April 20, 2004 at 09:32:32 (EDT)
I predict that my mom will like the eagle.
Chris 6 103
USA - Tuesday, April 20, 2004 at 09:31:27 (EDT)
i predict that my mommy will likethe dog.
nathalia 6
USA - Tuesday, April 20, 2004 at 09:30:11 (EDT)
I predict that my mom will like the eagle
Chris 6 103
USA - Tuesday, April 20, 2004 at 09:30:07 (EDT)
I predict that my mom will like the egal
Paulina AND LEAH 6 103
USA - Tuesday, April 20, 2004 at 09:29:14 (EDT)
I PRODICT THAT MY MOM WILL LIKE THE DOG
Neil 6,103
USA - Tuesday, April 20, 2004 at 09:29:11 (EDT)
I predict that my mom will like the dog. I like the elaphant.
waylon 103
USA - Tuesday, April 20, 2004 at 09:28:44 (EDT)
I predict that my mother will like the dog.
Alemina k.,9,401
USA - Tuesday, April 20, 2004 at 09:27:59 (EDT)
I predict that my mom will like the dog
Charlie 6 103
USA - Tuesday, April 20, 2004 at 09:27:37 (EDT)
I predict that my mother would like the cheetah
Adam 9,402
USA - Tuesday, April 20, 2004 at 09:25:57 (EDT)
I predict that my mom will like the egal.
Eileen 7,103
USA - Tuesday, April 20, 2004 at 09:25:56 (EDT)
I PRODICT THAT MY MOM WILL LIKE THE DOG.
MIKE 7 103
USA - Tuesday, April 20, 2004 at 09:25:50 (EDT)
I predict that my mom will like the cheetah.
Bodhi 7, 103
USA - Tuesday, April 20, 2004 at 09:17:28 (EDT)
Dear Ms. Steincke, This is really a test message from Mr. Stein.
Hahahahaha
John 6 203
USA - Tuesday, April 20, 2004 at 08:38:48 (EDT)
Hi Mr. Stein im sorry i havcent wrote in a long time its just i
have been to busy ok see you on friday. bye!
Laureta L.,10, class 503
new york, ny USA - Monday, April 19, 2004 at 18:03:23 (EDT)
I hate this school
Karen Dubosky
Astoria, N.Y. USA - Monday, April 19, 2004 at 16:33:48 (EDT)
I like the elephant because it was interesting. Thank you very much.
Joon 1-218 P.S.205Q
Bayside, NY USA - Monday, April 19, 2004 at 15:43:36 (EDT)
I like the elephant because it was interesting. Thank you very much.
Joon 1-218 P.S.205Q
Bayside, NY USA - Monday, April 19, 2004 at 15:42:23 (EDT)
dear mrs.steinke: I learned that a wale eats 40,million krill during
its feeding season.
kevin 7 203
USA - Monday, April 19, 2004 at 13:02:07 (EDT)
to Ms. Steincke:I know that a whale is larger than 3 school buses.
Katrina 7 203 PS101
Forest Hills, NY USA - Monday, April 19, 2004 at 13:01:46 (EDT)
to ms.Steincke, I leaned that a whales are as long 27 elephents.
lily 7 203
NYC, USA - Monday, April 19, 2004 at 13:01:32 (EDT)
dear mrs.steinke: I learned that a wale eats 40,million krill during
its feeding season.
kevin 7 203
USA - Monday, April 19, 2004 at 13:01:09 (EDT)
dear mrs.steinke: I learned that a wale eats 40,million krill during
its feeding season.
kevin 7 203
USA - Monday, April 19, 2004 at 13:01:09 (EDT)
TO MS STEINCKE I LEARNEDTHAT A BLUE WHALE WEIGH OVER 400,4000.
helena 7 203
USA - Monday, April 19, 2004 at 13:00:54 (EDT)
To Mrs.Steincke:whales weigh 400,000 pounds and are larger then
three school buses. They eat krill.
Alison 8 203
USA - Monday, April 19, 2004 at 12:58:03 (EDT)
to Ms.Steincke-blue whales are difficult to study.
Armando 7 203 PS101Q
Forest Hills, N.Y. USA - Monday, April 19, 2004 at 12:51:33 (EDT)
to ms. stencke:did you know the blue whale is the biggest animal
in the world? it is bigger than you!
elise 203
USA - Monday, April 19, 2004 at 12:50:50 (EDT)
To Steincke; Whales are as long as three school bus.
Bernice 7 203
USA - Monday, April 19, 2004 at 12:48:40 (EDT)
TO Mrs. Stiencke:I leaned that whales are the largest mammal in
the world!
Jessica 7 203
NYC, NY USA - Monday, April 19, 2004 at 12:46:48 (EDT)
To : Ms stenke I learn That In spring and early summer, blue whales
migrate from warm tropical waters to colder regions rich with krill. They
filter their tiny prey out of the water using comblike baleen
hassan 8 203
USA - Monday, April 19, 2004 at 12:42:23 (EDT)
TO M. steincke: whales weigh over 400,000 pounds
raymond 7 3
USA - Monday, April 19, 2004 at 12:23:11 (EDT)
To Ms. Steincke: Whales have been seen in every ocean.
Alison 8 203
USA - Monday, April 19, 2004 at 12:19:47 (EDT)
I think that your optical illisions are really hot . They are really
off the chain and tight.
MiShel ,11, 504 ,Public School 54 queens
Richmond Hill , ny USA - Monday, April 19, 2004 at 09:07:13 (EDT)
Once apon a time lived a cat and a dog. They were best friends.
One day, they went to a park. Each of them were using each subject in the
playground. The dog went on the slide,swings and the teeter-totter. The
cat went on the monkey bars,teeter-totter,and the jungle gym. Then the
dog said,"I'm tired,let's have a drink of water." The cat agreed. So they
went to the water fountain and got a drink. After that, they said goodbye
and went home. The dog did this: He took his bath,brushed his teeth,and
got a bedtime story and soon fell asleep. This is what the cat did: She
took a bath,brushed her teeth,and went to sleep. Soon it was the morning
to have a 2nd great adventure! The End
Alicia 7 2-204
USA - Sunday, April 18, 2004 at 21:18:35 (EDT)
MESSAGE FROM MR.STEIN: HELLO EVERYONE. LISTEN TO THE ANNOUNCEMENT
ON MONDAY MORNING. I HAVE CHOSEN THE WINNERS FOR THE 8 BEDTIME STORIES
THAT I LIKE BEST. THE BEST WIN A CRYSTAL EGG. SOME OTHER STUDENTS WILL
WIN A SWEET TREAT. I WILL POST TO THE WEBSITE ALL THE NAMES OF THE STUDENTS
THAT WROTE ME COMPLETE BEDTIME STORIES FROM HOME. SEEYA.
Mr. Stein
USA - Sunday, April 18, 2004 at 12:28:27 (EDT)
my mom likeed the eagle
valentina,8,2-201
USA - Sunday, April 18, 2004 at 11:43:55 (EDT)
Robinhood and his merry men. He steals from rich and gives to the
poor. He falls in love with Maid Merriam and duals the Sherrif John for
her hand in marriage. Robinhood wins the dual and gets Maid Merriam and
saves the kingdom for the return of King Richard who is away fighting the
crusade.
krishen , 6, ko13, ps, 101
queens, nys USA - Saturday, April 17, 2004 at 19:41:12 (EDT)
MESSAGEA FROM MR, STEIN TO: anna 7 ps101 2-202,Julia 5 k-014 Emily
W. 6 101 ps101, YOU ALL DID A WONDERFUL JOB IN PREDICTING WHICH HANDPAINTING
YOUR MOM WOULD LIKE. DID YOU HAVE FUN? I AM SURE THAT YOUR MOM THINKS YOU
ARE ALL SOOOOO SMART! I THINK YOU ARE SMART TOO. SEE YOU MONDAY.
MR. STEIN
USA - Friday, April 16, 2004 at 23:04:01 (EDT)
My mom liked the earth hand painting the best.
anna 7 ps101 2-202
USA - Friday, April 16, 2004 at 21:30:20 (EDT)
I was wrong she liked the eagle. I like the world
Julia 5 k-014
USA - Friday, April 16, 2004 at 19:27:29 (EDT)
I liked the world in hand panting the best. MY PREDICTION IS THAT
MY MOM WILL LIKE THE WORLD BEST.
Emily W. 6 101 ps101
USA - Friday, April 16, 2004 at 19:06:32 (EDT)
The cheatta and the Dog was good
Daiquan,10,P.S.38
New York City, NY USA - Friday, April 16, 2004 at 14:32:03 (EDT)
The cheatta and the Dog was good
Daiquan,10,P.S.38
New York City, NY USA - Friday, April 16, 2004 at 14:32:01 (EDT)
The cheatta and the Dog was good
Daiquan,10,P.S.38
New York City, NY USA - Friday, April 16, 2004 at 14:28:53 (EDT)
Thisa very intersting.The egle was the best one very very very interesting
Daniel and Brain 11 10 5-201
NY, NY USA - Friday, April 16, 2004 at 14:26:06 (EDT)
I like world
chelsea E 4-215 ps 205
bayside, ny USA - Friday, April 16, 2004 at 14:24:41 (EDT)
it was fun to do. i think that eagle was the best out of all them.
loriann 11 5-201
ny, USA - Friday, April 16, 2004 at 14:23:52 (EDT)
garvin
garvin 10
USA - Friday, April 16, 2004 at 14:15:16 (EDT)
it is very good
garvin ulysse
newyorkcity, ny USA - Friday, April 16, 2004 at 14:13:28 (EDT)
i like the dog hand paitning the best
sonya,9,4-215,PS205Q
newyork, USA - Friday, April 16, 2004 at 14:12:47 (EDT)
I like the Eagle
Daniel O 4-215 P.S.205
New York, N.Y. USA - Friday, April 16, 2004 at 14:11:36 (EDT)
my favorite handpainting was the cheetah because that's my favorite
animal
jasmine b 4-215 p.s 205
bayside, ny USA - Friday, April 16, 2004 at 14:09:46 (EDT)
"wow" "That is very cool handpaintings. I like the eagle! "Cool
web".
Kevin 4-215 P.S.205
New York, New york USA - Friday, April 16, 2004 at 14:09:04 (EDT)
I Like The Eagle.
Allison L 4-215, P.S.205
Bayside, N.Y USA - Friday, April 16, 2004 at 14:08:41 (EDT)
THE CHEETAH WAS THE BEST HAND-PAINTING.
SIDHARATH A 10 4-215 P.S.205
BAYSIDE, NEW YORK USA - Friday, April 16, 2004 at 14:08:03 (EDT)
I like the dog the most.
Amanda V 4-215 P.S.205
Bayside , NY USA - Friday, April 16, 2004 at 14:08:02 (EDT)
I liked the dog best it was cool
Deny W. 4-215 P.s.205
Bayside , n. N.Y. USA - Friday, April 16, 2004 at 14:07:57 (EDT)
My favorite is the Eagle.Thank you.
Jing H. 4-215 P.S.205
Bayside , NI USA - Friday, April 16, 2004 at 14:07:53 (EDT)
I Like The Eagle.
Allison L 4-215, P.S.205
Bayside, N.Y USA - Friday, April 16, 2004 at 14:07:48 (EDT)
I like a cheetah.
christina R 4-215 P.S 205
Bayside, N.Y USA - Friday, April 16, 2004 at 14:07:46 (EDT)
I liked the cheetah because it looks realistic
Danielle L. 4-215 P.S.205
fresh meadows, N.Y USA - Friday, April 16, 2004 at 14:07:40 (EDT)
my favorite handprint was the elephant
Jasmine B 4-215 P.S 205
bayside , ny united states - Friday, April 16, 2004 at 14:07:09 (EDT)
i liked the chetta best it was very cool
katherine c 4-215 205
new york, new york USA - Friday, April 16, 2004 at 14:06:55 (EDT)
I liked the cheetah the best. That handpainting website was awsome.
I loved it.
Natalie.J. 4-215 P.S.205
Bayside, NY USA - Friday, April 16, 2004 at 14:06:54 (EDT)
The chetta was the best. Thanks
beebarg R. 4-215 P.S.205
Bayside, NY USA - Friday, April 16, 2004 at 14:06:54 (EDT)
I like the cheetah. Thank you
Brandon V 4-215 P.S.205 Bayside
USA - Friday, April 16, 2004 at 14:06:53 (EDT)
The painting that I liked the best was the cheetah. I thought it
was a real picture of a cheetah. Thanks for showing me these really cool
pics!
Julia A.- 4-215 P.S.205
BAyside, NY USA - Friday, April 16, 2004 at 14:06:44 (EDT)
My favorite hand painting was the dog because it was cute. Thank
you. I really like this website.
Jean L,4-215,P.S.205Q
Bayside, NY USA - Friday, April 16, 2004 at 14:06:43 (EDT)
i loved the dog handpainting it was so cool. i loved your webstite
sandra 4-215 ps205
bayside, ny USA - Friday, April 16, 2004 at 14:06:40 (EDT)
***MESSAGE FROM MR. STEIN: HELLO TO P.S. 38 and Welcome! Which activity
do you like the best? Please let me know by writing a guestbook message.
Mr. Stein Web Master
USA - Friday, April 16, 2004 at 13:46:21 (EDT)
I like the hand art.I mean they are very creative.It is cool how
they can make handpainting look like animals. 17y nw
Tristina/10/5-201
New York City, Ny USA - Friday, April 16, 2004 at 13:02:38 (EDT)
hello marylou
hillary 202
USA - Friday, April 16, 2004 at 12:59:32 (EDT)
I like learning about whales. I am looking forward to the trip.
Hillary 202 not telling
USA - Friday, April 16, 2004 at 12:56:35 (EDT)
iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii8iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiloved
iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiit
iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiit wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwas
ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssso iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiintresting.
my favorite was the dog 17yNW
Nataly/10/5-201 Ps38
New York City, ny USA - Friday, April 16, 2004 at 12:46:26 (EDT)
I think they are creative .I think it's cool how they make paintings
with there hand.My favorite animal was the eagle because it is nice how
they make the fingers for the wings. .17ynw
Tristina/10/5-201 PS38
New York City, NY USA - Friday, April 16, 2004 at 12:40:08 (EDT)
HELLO TO P.S. 54 STudents and Staff. Please let me know your favorite
activity. Would you like a challenge? Find out what Mr. Stein looks like.
After you ENTER OUR WORLD" locate and click on "Put Mr. Stein Together".
It is in the center column on the bottom. Let me know if you complete it!!!
Enjoy.
Mr. Stein - P.S> 101 Web Master
USA - Friday, April 16, 2004 at 12:38:36 (EDT)
I think they are creative .I think it's cool how they make paintings
with there hand.My favorite animal was the eagle because it is nice how
they make the fingers for the wings. .
Tristina/10/5-201 PS38
New York City, NY USA - Friday, April 16, 2004 at 12:35:10 (EDT)
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIloved
it.My favorie animal was the dog it was creative
Nataly/10/5-201 Ps38
New York City, ny USA - Friday, April 16, 2004 at 12:34:18 (EDT)
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIt
was very intresting
Nataly/10/5-201 Ps38
New York City, ny USA - Friday, April 16, 2004 at 12:30:44 (EDT)
I like the hand art.I mean they are very creative.It is cool how
they can make handpainting look like animals. 17y nw
Tristina/10/5-201
New York City, Ny USA - Friday, April 16, 2004 at 12:28:14 (EDT)
this website is so cool i love this site
daveena ,11,6-337
queenz, ny USA - Friday, April 16, 2004 at 12:20:21 (EDT)
I thought that the Eagle was the most creatve, and it was the best
out of all of them. The problem I had was I could not pick out of the Cheetah
and the Eagle but I finely picked the Eagle was the best. 17YNW
Jacyann/11/5-201 P.S.38
New york city, NY USA - Friday, April 16, 2004 at 11:52:50 (EDT)
i like the cheetah
rashawn 11 5-201
new york, USA - Friday, April 16, 2004 at 11:39:40 (EDT)
II like the world.I prodict that it is going too win
Adrienne 7 101
USA - Friday, April 16, 2004 at 10:05:02 (EDT)
I like the dog painting the best.
kathy 5 k-013
USA - Friday, April 16, 2004 at 09:45:47 (EDT)
I LIKE ELAFIT
Andy 5 k-013
USA - Friday, April 16, 2004 at 09:43:10 (EDT)
cheetah
andrea 5 k013
USA - Friday, April 16, 2004 at 09:40:41 (EDT)
I LIKE ELAFIT
Andy 5 k-013
USA - Friday, April 16, 2004 at 09:39:59 (EDT)
I LIKE ELAFIT
Andy 5 k-013
USA - Friday, April 16, 2004 at 09:39:05 (EDT)
i liked when mr stien kisis mrs bedy
sebastian g k012 6
USA - Friday, April 16, 2004 at 09:38:13 (EDT)
I like eagle
Kevin 6 K013
USA - Friday, April 16, 2004 at 09:38:08 (EDT)
ilikit the eagle
krishen 6 k012
USA - Friday, April 16, 2004 at 09:38:06 (EDT)
I like the dog painting the best
kathy 5 k-013
USA - Friday, April 16, 2004 at 09:36:42 (EDT)
I like ceeta.
Julia B. 5 K013
USA - Friday, April 16, 2004 at 09:34:25 (EDT)
I ilke ELAFIT.
Andy 5 k-013
USA - Friday, April 16, 2004 at 09:33:54 (EDT)
I ilke pokemon moves
Andy 5 k-013
USA - Friday, April 16, 2004 at 09:32:02 (EDT)
i liked eagle
michael v. 5 k013
USA - Friday, April 16, 2004 at 09:30:47 (EDT)
i liked eagle
michael v. 5 k013
USA - Friday, April 16, 2004 at 09:30:03 (EDT)
i liked the cheetah
Julia b 5 ko13
USA - Friday, April 16, 2004 at 09:25:00 (EDT)
I enjoy the pictures.
Raymond,11,502
Richmond hill, NY USA - Friday, April 16, 2004 at 09:11:16 (EDT)
I totally liked your website dudes. I liked the optical illusions.
My favorite one is the "rabbit or duck" illusion. TOTALLY RAD WEBSITE!!!!!!!!!!!
mushfiqur, 11, 502
new york city, ny USA - Friday, April 16, 2004 at 09:11:08 (EDT)
I enjoyed your ellousion pictures that I would love to see more
of unusal pictures
FRANCISCO 12 5-502
RICHMOND HILL, NY USA - Friday, April 16, 2004 at 09:10:25 (EDT)
this is cool!
michael,10,5-502
nyc, ny USA - Friday, April 16, 2004 at 09:09:52 (EDT)
I enjoyed your ellousion pictures that I would love to see more
of unusal pictures
FRANCISCO 12 5-502
RICHMOND HILL, NY USA - Friday, April 16, 2004 at 09:09:30 (EDT)
i think your web site is cool Iam really enjoying your website bye
Lissette 502 11
richmonhill, ny USA - Friday, April 16, 2004 at 09:08:56 (EDT)
cool "totally".
Baljit, 11 , 502
New York, NY USA - Friday, April 16, 2004 at 09:08:16 (EDT)
Great activities they were FUN!!!!!!!!!!!!!
Claudia Reyes 502
Richmond,Queens , N.Y. USA - Friday, April 16, 2004 at 09:08:03 (EDT)
Totally cool web dudes
Cynthia,11,P.S.54
USA - Friday, April 16, 2004 at 09:07:35 (EDT)
I LIKE THE CHEETAH. my prediction is that my mom will like the cheetah
best.
tony 6 101
Forest Hills, ny USA - Friday, April 16, 2004 at 09:07:01 (EDT)
I like the eagle best. My prediction is that my sister will like
the dog best
Emily ciass101
Queens, USA - Friday, April 16, 2004 at 09:06:51 (EDT)
i injoyed your website. do you like the shool?
melina 11 502
USA - Friday, April 16, 2004 at 09:06:15 (EDT)
Totally cool web dudes
Cynthia,11,P.S.54
USA - Friday, April 16, 2004 at 09:05:51 (EDT)
I REALLY ENJOY YOUR WEBSITES.THIS IS THE BEST!!!!!!!!!!!
PS.54.Q,11,CAROLINA
N.Y USA - Friday, April 16, 2004 at 09:05:33 (EDT)
i liked the dog. my prediction is that my babysitter will like the
elephant
Karla 101 6
USA - Friday, April 16, 2004 at 09:05:22 (EDT)
I like the world the best. MY PREDICTION IS THAT DAD WILL LIKE THE
WORLD THE BEST.
Emily W. 6 101
USA - Friday, April 16, 2004 at 09:04:59 (EDT)
I hated the pictures.
Ian 6 101
USA - Friday, April 16, 2004 at 09:04:18 (EDT)
I liked the eagle the best from the handpainting place.MY PREDICTION
IS THAT MY SISTER WILL LIKE THE DOG BEST.
Will 6 class 101
Queens, NY USA - Friday, April 16, 2004 at 09:03:46 (EDT)
cool web site dood.
sharde
ozone park, ny USA - Friday, April 16, 2004 at 09:03:38 (EDT)
I don't like any of the hand paintings. My prediction is my dad
wont like any either.
Harrison 7 101
USA - Friday, April 16, 2004 at 09:02:44 (EDT)
I liked the cheetah best. MY PREDICTION IS THAT MY BABY SITTER WILL
LIKE CHEETAH
Natalie 7 101
USA - Friday, April 16, 2004 at 08:50:22 (EDT)
MESSAGES FROM MR. STEIN TO P.S. 205 ** WELCOME TO THE EMAGINATORIUM...
WANT TO SEE MY PICTURE? LEAVE ME A MESSAGE?
Mr. Stein - Computer Teacher
USA - Friday, April 16, 2004 at 05:27:20 (EDT)
evrf cge4drxgfvr6ydbefvgt64edbftyedf vghrexf gvthghbyfrgbyftcgfvtttttttttvgfttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
yfghdgrftfrgvetr5dbghgcfrt4hbdngdtr5bywyrgtfr56fy4h5t64gtr5dy43
USA - Thursday, April 15, 2004 at 19:24:45 (EDT)
i like hand painting
wenyi 5 ko14
USA - Thursday, April 15, 2004 at 19:20:58 (EDT)
I liked the rooster.
Elizabeth Nevins, MS131
NY, NY USA - Thursday, April 15, 2004 at 17:42:20 (EDT)
I like the giraffe
Johnny 5 k012
USA - Thursday, April 15, 2004 at 16:59:17 (EDT)
My mom liked the elaphant I was wrong about my mom liking the giraff
Granit Lahu Class 201
Forest Hills, ny USA - Thursday, April 15, 2004 at 15:26:46 (EDT)
I put your puzzle together and saw a younger, slimmer Dan. Very
handsome! Loved your web site and still miss you! What is your web address??
Love, your old prodigy
DG <dgindi@hotmail.com>
Merrick, NY USA - Thursday, April 15, 2004 at 14:39:51 (EDT)
I really liked the cheetah because Ilike cheetahs.
Steven P.S205
USA - Thursday, April 15, 2004 at 14:19:55 (EDT)
I really liked your website! It was really cool!!!! I really liked
the cheeta.
Kalene R 9 PS.205 3 -236
Bayside , N.Y USA - Thursday, April 15, 2004 at 14:18:24 (EDT)
I really like the Cheetah because the Ceetah is my favoret.
Matthew D.
USA - Thursday, April 15, 2004 at 14:18:21 (EDT)
I really liked the cheetah.It was a really cool picture.I liked
the cheetah because cheetahs are fast runners and they eat meat.
Kevin C,9,CLASS-3-236
USA - Thursday, April 15, 2004 at 14:18:20 (EDT)
THE Eagel was very cool.You are good at arts and crafts.
David P.S205
Bayside, NY USA - Thursday, April 15, 2004 at 14:17:58 (EDT)
I really like the Cheetah.Thumbs Up!I think it is really cool.I
liked the cheetah because cheetah's are cool.
Shaunna-Tiffany,PS205,3-236
Bayside, USA - Thursday, April 15, 2004 at 14:17:50 (EDT)
I Really Like The Eagle,It's cool,and nice.
Jared P.s205
Bayside , NY USA - Thursday, April 15, 2004 at 14:17:46 (EDT)
I really like the Cheetah because it is the best handprint.
YoungC. P.S.205
USA - Thursday, April 15, 2004 at 14:17:33 (EDT)
I really like the eagle.It's cool,maybe you can teach me to.
Nicholas P.S.205
Bayside, NY USA - Thursday, April 15, 2004 at 14:17:25 (EDT)
Hey everybody! I just went to your sieng site and I liked all of
them but the animal I liked the most was the rooster. I liked the rooster
the best because I think it was hard to make the animal with your fingers.
Carl D.,P.S.205
Bayside, NY USA - Thursday, April 15, 2004 at 14:17:11 (EDT)
I really like the picture of the eagle. It's cool.Mabe I can teach
my family and we can do the eagle one day.Thanks!
Rebecca P.S.205 Class3-236
Bayside, NY USA - Thursday, April 15, 2004 at 14:17:09 (EDT)
I really liked your website! It was soooooooo cool!!!!!!!! I liked
your cheeta hand.How did you do it? I think you're creative.
Alice X. 8 P.S.205 3-236
Bayside, N.Y USA - Thursday, April 15, 2004 at 14:17:07 (EDT)
Hello everybody I really liked the other animals
Maya.I 8 P.s205 3-236
USA - Thursday, April 15, 2004 at 14:16:57 (EDT)
I really like the Cheetah because it is the best handprint.
YoungC. P.S.
USA - Thursday, April 15, 2004 at 14:16:56 (EDT)
I like the cheetah. It is cool. I wish I went to your school. This
is amazing, I like it!
Kevin K. P.S.205Q 9 3-236
USA - Thursday, April 15, 2004 at 14:16:47 (EDT)
the cheeta is the best thing i like also that was incredable!!!
you do the best hand painting ever that i ever espesally the cheeta!!!
however;all of the were the things are the best!!!!
Susanna,PS.205
Bayside, NY USA - Thursday, April 15, 2004 at 14:16:41 (EDT)
I like the cheetah.If i came to that school i can tell it will be
amazing,fantastis,wonderful,and of course great.I would like to be apart
of the school's program.
naeem p.s 3-236
USA - Thursday, April 15, 2004 at 14:16:16 (EDT)
I realy like the cheeta,and I want to know how do you paint your
hands.
Naz,P.S.2O5,3-236
New York, US USA - Thursday, April 15, 2004 at 14:16:16 (EDT)
I like the cheeta best because they're really fast & cool.
Pradeep 3-236
USA - Thursday, April 15, 2004 at 14:16:14 (EDT)
I like the girrafe. It's cool!
vanessa PS.205
vallystream, NY USA - Thursday, April 15, 2004 at 14:16:02 (EDT)
(actually, the Guest Book submission page has the spelling error)
Deaprtment
Mr. Blum P.S. 205
Bayside , NY USA - Thursday, April 15, 2004 at 14:15:50 (EDT)
I like the girrafe. It's cool!
vanessa PS.205
vallystream, NY USA - Thursday, April 15, 2004 at 14:15:06 (EDT)
I like the cheetah the most! It's cool!
Peggy P.S.205
Bayside, USA - Thursday, April 15, 2004 at 14:14:56 (EDT)
Mr. Stein, My students here at PS 205 love the handpaintings and
all of your other cool links! Thanks! P.S. The Guestbook page has a spelling
error at the top 'New York City Deaprtment of Education, Region 3'
Mr. Blum P.S. 205
Bayside , NY USA - Thursday, April 15, 2004 at 14:14:39 (EDT)
The cheetah was very cool almost all my frinds liked it.
Daniel PS 205
USA - Thursday, April 15, 2004 at 14:14:02 (EDT)
a cat in the the dog
tim
ff, ny USA - Thursday, April 15, 2004 at 12:51:04 (EDT)
I love the picture if the dog and the Cheetah it was really creative
if I had the chance to do such good art work as you I would.
P.S. 205Q Jheanelle Lue
Bayside, NY USA - Thursday, April 15, 2004 at 12:38:21 (EDT)
I like the eagle hand painting the best.
Stefan W. 11 P.S.205Q
Bayside, N.Y. USA - Thursday, April 15, 2004 at 12:37:32 (EDT)
THIS is great. Good job!
Christina T.
Bayside, N.Y USA - Thursday, April 15, 2004 at 12:37:12 (EDT)
I liked the cheetha and the dog.THis is very cool!
P.S.205Q Erik P.
Bayside new york, USA - Thursday, April 15, 2004 at 12:37:01 (EDT)
My favorite hand painting is the cheetah.
Lorrie Ann M. 10 P.S205
Bayside, NY USA - Thursday, April 15, 2004 at 12:36:52 (EDT)
You have very neat stuff. and you were able to persuade me 100%.
We don't know ... I might come to your school!!
P.S.205Q George H.
Bayside, USA - Thursday, April 15, 2004 at 12:36:45 (EDT)
I love your web site it has many beautiful things. It's amazing!
P.S.205queens, Sasha
Bayside , N.Y. USA - Thursday, April 15, 2004 at 12:36:43 (EDT)
I thought the cheeteh was the best one there
PS205Q Ariel L
Bayside, NY USA - Thursday, April 15, 2004 at 12:36:41 (EDT)
I like the eagle. How do you do it?
PS 205 KELSON 10
USA - Thursday, April 15, 2004 at 12:36:35 (EDT)
I like the eagle the best.
Stefan W. 11 P.S.205Q
Bayside, N.Y. USA - Thursday, April 15, 2004 at 12:36:34 (EDT)
i liked the dog the best because u made it look so real you did
a great job!
Kaitlyn T. 11, P.S.205
Bayside , NY USA - Thursday, April 15, 2004 at 12:36:34 (EDT)
My favorite is chicken.
Christine H. P.S.205
Bayside, Ny USA - Thursday, April 15, 2004 at 12:36:33 (EDT)
I loved the eagle with the hands. It is really cool how they did
that with their bare hands.
Rebecca S 11 5-217
bayeside, NY USA - Thursday, April 15, 2004 at 12:36:32 (EDT)
I like the hand painting with the cheetah on it. Others are good
too.
P.S.205Q Irene
Bayside, NY USA - Thursday, April 15, 2004 at 12:36:31 (EDT)
I like the Cheetah best. you are very good with this website. It
is amazing!!!!!!!!!
Ps205Q Genesis
Bayside, NY USA - Thursday, April 15, 2004 at 12:36:31 (EDT)
I liked the cheetah, It was very realistic I couldn't tell it was
a hand
P.S.205. Gabriel B.
Bayside, NY USA - Thursday, April 15, 2004 at 12:36:21 (EDT)
My favorite handpainting is the painting of the cheetah. THe hompage
is very nice and artistic.
P.S.205Q Royce P.
Bayside, NY USA - Thursday, April 15, 2004 at 12:36:19 (EDT)
Well my favorte is the dog
P.S.205Q Kevin S. 10
bayside, N.Y USA - Thursday, April 15, 2004 at 12:36:15 (EDT)
I liked the cheetah and the girrafe
Imani B, P.S.205
USA - Thursday, April 15, 2004 at 12:36:11 (EDT)
I like the cheetah.It is cool. It looks very real.
P.S.205Q Gaelen L.
bayside, NY USA - Thursday, April 15, 2004 at 12:36:03 (EDT)
I really like the dog it is very cute! JESS
jess m. 11 P.S.205
basyside, ny USA - Thursday, April 15, 2004 at 12:36:00 (EDT)
I really liked the cheeta painting the most because it looks like
it is real and not a hand. It has a lot of imagination in it.
P.S. 205Q
Bayside, NY USA - Thursday, April 15, 2004 at 12:36:00 (EDT)
my favorite is the eagle it has a very artistic point of view
P.S205Q B
bayside, NY USA - Thursday, April 15, 2004 at 12:35:52 (EDT)
the hands were very cool
PS205,Aaron
Bayside, USA - Thursday, April 15, 2004 at 12:35:50 (EDT)
The eagle is my favorite
Dillan L. PS 205
USA - Thursday, April 15, 2004 at 12:35:45 (EDT)
i like the Chetah. it is creativeity
Victoria H 11P.S.205 class 5-217
Bayside, ny USA - Thursday, April 15, 2004 at 12:35:43 (EDT)
My favorite is the eagle.
George Y, 11, PS 205
Bayside, NY USA - Thursday, April 15, 2004 at 12:35:29 (EDT)
Thank you so much for all your help and support, we really miss
you at Halsey.
Anita Greenhut, Assistant Principal
JHS 157, USA - Thursday, April 15, 2004 at 12:24:39 (EDT)
I LIKEIEDK NRTYBVCXZJKLMNASRTWQUOPI TRRTGV ,KKGLKDRN EHJSB HJDFN
GT6YMHUNMKDFWET67R7IUR7RKJEIUEIURLMNKG-HJLP[./HJ. ,BN VBMNJGJGNGNJFJNFNNCNMMNCKMDJKEIOJRFJIORKJMNVM,BLMPCKLVJKLITKLGFKLMFKVFJFHJTDRJHFKJHJFJKDJKDFKJLSDF
JNFSNRFJKFGFKL;RTKJKGKTTHBUUHHUUIIYUHVSGFFGFAWGVSGSGSDHRGGFGEGD ZC ZSCV
ZSdmdhfhdhfhb.dbwASjsjuyseusz.7zsd.8.r6..56.54..54r.g.cd..vc.cxvxcvcsbvvcccc
.'/mlv-ioi90gctyxgu9igyuxji90cfyjuyskcxu-svx-vvvxvxvxczcx czvzv llz, l
WENYI 6 KO14
USA - Thursday, April 15, 2004 at 10:34:45 (EDT)
I think those pictures were really interesting.
Valerie P. 9 4-216 P.S.205Q
Bayside, USA - Thursday, April 15, 2004 at 10:28:46 (EDT)
I love the handpaintings. They were very creative. I am looking
forward to coming to this website again.
Alex A. AGE 10 PS 205q class 4-216
Bayside, NY USA - Thursday, April 15, 2004 at 10:25:40 (EDT)
I like your web site the hand painting it is rely cool.
jonpaulPS205 10 4-216
bayside, NY USA - Thursday, April 15, 2004 at 10:23:20 (EDT)
I think you're website is very entertaining.
Jasmine B, 9, 4-216
Bayside, NY USA - Thursday, April 15, 2004 at 10:23:02 (EDT)
The hand painting project was so cool! I liked all the hand paintings!
Great job!
Clara C., 9,P.s.205Q 4-216
Bayside, ny USA - Thursday, April 15, 2004 at 10:23:01 (EDT)
I think this was really cool. My favorite one was the elephant.
Alexandra A. age 9 P.S.205 class 4-216
Bayside, N.Y. USA - Thursday, April 15, 2004 at 10:22:56 (EDT)
I liked the Dog. How did you make the world. I hope you start to
make new ones.
Eugene B. 9 P.S.205
Bayside, NY USA - Thursday, April 15, 2004 at 10:22:53 (EDT)
I liked the world, Cheetah, dog, graffe, eagle, elephsnt, and the
chicken
Katherine H. P.S.205
Bayside, N.Y. USA - Thursday, April 15, 2004 at 10:22:51 (EDT)
My favorit one is the cheetha.
Tyese P . 10 4-216 Ps 205q
Bayside, NY USA - Thursday, April 15, 2004 at 10:22:41 (EDT)
I loved the hand paintings! I would like to know how you did them.
I think you should win a handpainting award.
Antoinette R. 10 4-216 P.S.205
Bayside, NY USA - Thursday, April 15, 2004 at 10:22:39 (EDT)
that was really cool !!!!!!!!!!!!!!!!!!1 i liked the idea of the
people's fingers being hjand panited
kinge-ann 4-216 P.S.205Q 9
Bayside, N.Y USA - Thursday, April 15, 2004 at 10:22:38 (EDT)
I think the hand painting was cool.^__^ I liked the eagle the best.^__^
bye.
P.S.205Q, Kevin L, Age:9
Bayside, N.Y USA - Thursday, April 15, 2004 at 10:22:37 (EDT)
I think the fingerpaintings are very very cool. I wonder how you
make them look so real?
E.C. 9 years old P.S.205 4-216
Bayside, NY USA - Thursday, April 15, 2004 at 10:22:36 (EDT)
I really liked the cheetah a lot because the girl or boy hand was
painted perfectly with no mistakes.
Catrell 4-216 P.S. 205 Q
Jamaica Queens, N.Y USA - Thursday, April 15, 2004 at 10:22:34 (EDT)
My favorite handpaintings were the dog, and the cheetah.They wer
really cool!
P.s205 Jordan.D 4-216 Age9
Bayside, NY USA - Thursday, April 15, 2004 at 10:22:33 (EDT)
I realy liked your hand paints they look awesome! You did a creative
job. I know other people will like it too.
Sayeeda C, 9, 4-216, P.S.205
jamaica, N,Y USA - Thursday, April 15, 2004 at 10:22:29 (EDT)
I think the hand-paintings looked very good. My favorite one was
the elephant. I thought that the elphant was the best.
Rocky C. 4-216, P.S.205
Bayside, NY USA - Thursday, April 15, 2004 at 10:22:25 (EDT)
I like your handpaintings very much they are cool!!!!!!!!!!!!!!!
They are very nice and pretty!!
Hetty C. 4-216 P.S.205Q
USA - Thursday, April 15, 2004 at 10:22:19 (EDT)
That Cheetah and that bird handprints were cool!
Michael K. P.S. 205 Age 9 Class4-216
Bayside, NY USA - Thursday, April 15, 2004 at 10:21:53 (EDT)
I think the hand-paintings looked very good. My favorite one was
the elephant. I thought that the elphant was the best.
Rocky 4-216 P.S.205
Bayside, NY USA - Thursday, April 15, 2004 at 10:21:51 (EDT)
I liked the cheetah and the eagle best. They looked cool!
Andrew J.P.S.205 4-216 9 years old
Bayside, N.Y. USA - Thursday, April 15, 2004 at 10:21:46 (EDT)
I think the hand-paintings looked very good. My favorite one was
the elephant. I thought that the elphant was the best, though.
Rocky 4-216 P.S.205
Bayside, NY USA - Thursday, April 15, 2004 at 10:21:42 (EDT)
My favorite handpaintings were the dog, and the cheetah.They wer
really cool!
P.s205 Jordan.D 4-216
Bayside, NY USA - Thursday, April 15, 2004 at 10:21:36 (EDT)
that was really cool.i liked the idea of the hant paint
kinge-ann 4-216 P.S.205Q 9
Bayside, N.Y USA - Thursday, April 15, 2004 at 10:21:30 (EDT)
It was cool.
Tracy C. 10 4-216 ps205
bayside, N.Y USA - Thursday, April 15, 2004 at 10:21:30 (EDT)
my favorite hand panting was the hand puppy
courtney P.S.205 9 yrs. old 4-216
rosdale, ny USA - Thursday, April 15, 2004 at 10:21:29 (EDT)
I like your handpaintings very much they are cool!!!!!!!!!!!!!!!
They are very nice and pretty!!
Hetty Cheng 4-216 P.S.205Q
USA - Thursday, April 15, 2004 at 10:21:27 (EDT)
I think the hand-paintings looked very good. My favorite one was
th elephant. I thought that the elphant was the best, though.
Rocky 4-216 P.S.205
Bayside, NY USA - Thursday, April 15, 2004 at 10:21:25 (EDT)
I liked the idea of the anmals-hands. I would like to try it!
michael 4-216 P.S.205
bayside, ny USA - Thursday, April 15, 2004 at 10:21:22 (EDT)
myf
rachel 6 k014
USA - Thursday, April 15, 2004 at 10:21:20 (EDT)
I like the world
Julia 5 k-014
USA - Thursday, April 15, 2004 at 10:19:21 (EDT)
I like the rooster
sunny 6 k-014
USA - Thursday, April 15, 2004 at 10:16:13 (EDT)
I like 3D
Joshua 5 k014
NYC, NY USA - Thursday, April 15, 2004 at 10:15:13 (EDT)
My mom will like the cheetah
david 6 k014
USA - Thursday, April 15, 2004 at 10:10:41 (EDT)
i like the cheetah
Valeska 5 k014
USA - Thursday, April 15, 2004 at 10:01:24 (EDT)
I
Rowena 6 Rachel 5 k011
USA - Wednesday, April 14, 2004 at 18:48:42 (EDT)
I
Rowena 6 Rachel 5 k011
USA - Wednesday, April 14, 2004 at 18:48:36 (EDT)
PS101 Rules
Julia 5 K-013
USA - Wednesday, April 14, 2004 at 18:00:24 (EDT)
My favorite is the eagle.
Mrs. Donadio PS117
Briarwood, NY USA - Wednesday, April 14, 2004 at 12:56:40 (EDT)
This is a great website!
Ms. Mollura PS 161
Richmond Hill, NY USA - Wednesday, April 14, 2004 at 12:56:28 (EDT)
My favorite is the girakffe
Mr. Stein PS101
USA - Wednesday, April 14, 2004 at 12:56:10 (EDT)
my favorite is the eagle
Gail Forsberg PS 41
USA - Wednesday, April 14, 2004 at 12:55:57 (EDT)
my favorite is the giraffe
Ms. Hogan very old
VS, NY USA - Wednesday, April 14, 2004 at 12:55:25 (EDT)
Great Handpainting! My favorite is the eagle!
Mr. Blum , Computer Teacher PS 205 Bayside
Bayside, NY USA - Wednesday, April 14, 2004 at 12:55:21 (EDT)
My favorite is the eagle!!
Mr. Morales
USA - Wednesday, April 14, 2004 at 12:55:02 (EDT)
I was in Washton D.C and I got two postcards for you to hang up
on the wall with the world map.
Emily W. 6 101
Forest Hills, NY USA - Wednesday, April 14, 2004 at 06:57:55 (EDT)
Wow. Thank you for all your bedtime stories. Thank you for all your
messages. They were fun. Later I will show you handpainting.
Mr. Stein
USA - Wednesday, April 14, 2004 at 04:57:17 (EDT)
i used to fave a bast friend named snowball and we had fun toghter
and everything but she got sink a died. thank you from judy you can right
me at **PLEASE NO EMAIL ADDRESSES**.
judy k 19 11
michgon, ohio USA - Tuesday, April 13, 2004 at 18:45:05 (EDT)
Hi Mr.Stein.I had a nice vacation.
isabella 7 202
USA - Tuesday, April 13, 2004 at 18:27:56 (EDT)
I hope I win the bedtime story contest!I wrote you a story about
the grasshopper and the ant.
Colleen 8 204
USA - Tuesday, April 13, 2004 at 18:19:56 (EDT)
Mr.Stin you are great to have you.you show me how to get ps101.webhop.org
thyou Mr.Stin for showing me how to get to ps101.webhop.org t
Rowena 6 6 k011
USA - Tuesday, April 13, 2004 at 18:16:17 (EDT)
Mr. Stein: I went to Washington D.C on saturday. I saw the Linclon
memorial. Washington D.C was so much fun. I even put some pictures in my
bookbag.
kathy 5 k-013
USA - Tuesday, April 13, 2004 at 17:39:10 (EDT)
Mr. Stein: I went to Washington D.C on saturday. I saw the Linclon
memorial. Washington D.C was so much fun. I even put some pictures in my
bookbag.
kathy 5 k-013
USA - Tuesday, April 13, 2004 at 17:38:33 (EDT)
Mr. Stein: I went to Washington D.C on saturday i saw the linclon
memorial Washington D.C was so much fun I even put some pictures in my
bookbag
kathy 5 k-013
USA - Tuesday, April 13, 2004 at 17:35:25 (EDT)
Once upon a time, there were a cute kitty named Mikky and a dog
named Barkey. They lived on a tree house and they were very happy and felt
safe. But! one day on a spooky day they had a terrible thunder storm. Strong
wind blew their tree house! Flood water washed away Mikky and Barkey. Finally
they arrived the unknown city! What they should do?They wandered in the
dark forest and they saw a hungry monster. They run and run and run! Finally
they got out of the dark forest. They were so hungry that they weren't
able to move, then a nice girl named Mai found them and saved them. They
lived happily forever!
Mai Kamio, 6, 103
USA - Tuesday, April 13, 2004 at 16:31:34 (EDT)
The fish was in the pond looking for someone to marry. Mina the
rainbow fish was hoping for that perfect man fish to marry. Finally, after
weeks of swimming around the pond and trying to find a nice fish, she met
one. His name was Michael. He was a strong fish with shiney gils. Mina
looked at him and saw that he was a rainbow fish too. So, she married him
and had lots ofr little rainbow fishes. And til this day, they still swim
around the pond. The End>
jacklyn 7 202
USA - Tuesday, April 13, 2004 at 10:21:20 (EDT)
MR. STEIN MESSAGES TO:Jordan 8 301- Here is a trick to copy something.
1. Select what you want (you could prerss print screen, if you want a picture
of the screen). 2. Hold down the Control Key (Ctrl) and then press "c".3.
Now that you have it copied, go to where you wish it placed (a new Word
document) and Hold down the Control Key (Ctrl) and press "v". Let me know
if it works...ALso ask your brother or sister. See you soon. ***** Hi Albert
D. Try 5the missing man. Ask your teachers to help. I am in a quandry.***
VictorL 9 302, Glad to see you did 10 words of the day while you were on
vacation..COOL!!!!. Your3 D glasses await you. BYE
Mr. Stein
USA - Tuesday, April 13, 2004 at 08:00:29 (EDT)
Hi, Mr.Stein!! Give my greetings to my former teachers also.
Albert D, 14, graduated
Forest Hills, NY USA - Monday, April 12, 2004 at 22:50:29 (EDT)
I will print April14 at computer
VictorL 9 302
NY, NY USA - Monday, April 12, 2004 at 21:20:49 (EDT)
Mr.stein I couldn't do the word of the day because the computer
at the library and my house didn't have edit paste in Shelter Island.
Jordan 8 301
USA - Monday, April 12, 2004 at 19:35:23 (EDT)
Mr.stein I couldn't do the word of the day because the computer
at the library and my house didn't have edit paste in Shelter Island.
Jordan 8 301
USA - Monday, April 12, 2004 at 19:35:21 (EDT)
Never uumm... mind my old message
Victor L 9 302
NY, NY USA - Monday, April 12, 2004 at 19:33:34 (EDT)
Never mind my old message I just sent you
Victor L 302 9
New York , USA - Monday, April 12, 2004 at 19:32:17 (EDT)
Never mind my old message I just sent you
Victor L 302 9
New York , USA - Monday, April 12, 2004 at 19:32:04 (EDT)
I will give Them To you on thursday
Victor L 302 9
New York, NY USA - Monday, April 12, 2004 at 19:29:04 (EDT)
I am Max. I am six years old. When I go to sleep I hear the countdown
and I'm in space. I can see the moon and the stars. And I see the planets,
the earth and the sun. Now I see meteorite. I almost crashed into the meteorite,
but I was safe. And it was morning. Max told eveyone about his adventure.
Max 6 Class103
USA - Monday, April 12, 2004 at 17:07:06 (EDT)
to Mr. Stein: I have a bedtime story for you. It is called "Hansel
& Gretel". Be careful who's candy house you eat! Bye.
Connor, 6, k011
USA - Monday, April 12, 2004 at 16:44:49 (EDT)
Dear Evelina, Can you please get my telephone number from Ms. Rodgers.
I would like to speak with you. Ryan
ryan simmons 6 k-012
reston, V.A USA - Monday, April 12, 2004 at 15:27:17 (EDT)
MR. STEIN MESSAGES TO:kathy k-013, What dis you like best about
Washington DC? ** To:victor l. 302 9. IF you printed all of Merriam Websters's
"Word Of The Day", and written a sentence for each, you have won a pair
of 3D glasses to see the 3D images on our website. Please bring those papers
to me on Wednesday morning. I am proud of you!
Mr. Stein
USA - Monday, April 12, 2004 at 07:04:24 (EDT)
I was at washington DC for two days
kathy k-013
USA - Sunday, April 11, 2004 at 22:51:08 (EDT)
I have all Word Of The Days from March 24 to now + I will have Until
April 13! see You
victor l. 302 9
New York, NY USA - Sunday, April 11, 2004 at 21:26:32 (EDT)
I have all Word Of The Days from March 24 to now + I will have Until
April 13! see You
victor l. 302 9
New York, NY USA - Sunday, April 11, 2004 at 21:26:27 (EDT)
MESSAGE TO YUJIN CLASS 403 To get to my tongue twister page, look
in "Sites to Behold" (Eyeballs) on my front page. Write me a message on
the guestbook to let me know which one you like best of all. See you soon!!!
Mr. Stein
Mr. Stein
USA - Sunday, April 11, 2004 at 06:55:16 (EDT)
Do you know this tongue twister Mr.Stein? I got it from Mr.Frank.
If you still have that tongue twister page, can you add it to that? "It's
not the cough that carries you off, it's often the coffin that they carry
you off in." Hope you like it!!
Yujin 10 402
Forest Hills, NY USA - Saturday, April 10, 2004 at 21:57:41 (EDT)
Hi Dan how are you doing. Dan you are a grate techer.
Daniel .t. 6 102
USA - Friday, April 09, 2004 at 11:05:05 (EDT)
hello. I am George. I am in Tokyo Narita
George, 12, 7th grade
USA - Friday, April 09, 2004 at 03:42:51 (EDT)
i like cats do you
anoosha 5 ko14
USA - Friday, April 09, 2004 at 00:42:23 (EDT)
HELLO TO KATHY K013, PLease send me a message from Washington D.C..
Tell me what you like best. BYE
MR. Stein
USA - Thursday, April 08, 2004 at 23:57:27 (EDT)
mr.stein:I'm going to washington DC I'm going to have a lot of fun
kathy 5 k-013
USA - Thursday, April 08, 2004 at 22:53:00 (EDT)
Hi Mr.Stine I like your website.Iv been on alot of things.
jaelah 7 102
USA - Thursday, April 08, 2004 at 19:31:12 (EDT)
Hi Mr.Stine I like your website.Iv been on alot of stuff.
jaelah 7 102
USA - Thursday, April 08, 2004 at 19:29:56 (EDT)
i wil rite you a story...by pranav onestheyer verarabbthevasplacingallthecaritsoutd
end
pranav 5 ko11.
USA - Thursday, April 08, 2004 at 16:55:46 (EDT)
i wil rite you a story...by pranav onestheyer verarabbthevasplacingallthecaritsoutd
end
pranav 5 ko11.
USA - Thursday, April 08, 2004 at 16:55:45 (EDT)
i wil rite you a story...by pranav onestheyer verarabbthevasplacingallthecaritsoutd
end
pranav 5 ko11.
USA - Thursday, April 08, 2004 at 16:52:38 (EDT)
HELLO FROM MR. STEIN TO: ISABELLA 5 K012, AMY 401 and her brother
ANDY 5 K-013. THANKS FOR THE COMPLIMENTS AND MESSAGES. SEE YOU SOON.
Mr. Stein
USA - Thursday, April 08, 2004 at 16:41:07 (EDT)
I have a book it is abowt a girl who wants to be a prinsess but
her mom dost let her
ISABELLA 5 K012
USA - Wednesday, April 07, 2004 at 18:01:10 (EDT)
I like Power Ranger Dino Thunder.
ANDY 5 K-013
manhattan, NY USA - Wednesday, April 07, 2004 at 17:46:14 (EDT)
I'm Amy's little brother.I'm in my Dad's office.
ANDY 5 K-013
NY, NY USA - Wednesday, April 07, 2004 at 17:43:32 (EDT)
Hello Hi Hello Hi Hello Hi Hello.
amy 401
NY, NY USA - Wednesday, April 07, 2004 at 17:37:36 (EDT)
I'm really in Manhattan!!!!!!!!!!!!!!!!
amy 401
NY, NY USA - Wednesday, April 07, 2004 at 17:35:54 (EDT)
ummmmmmmmmmmmmmmm.
amy 401
NY, NY USA - Wednesday, April 07, 2004 at 17:34:46 (EDT)
You really are a great computer teacher though!!
amy 401
NY, NY USA - Wednesday, April 07, 2004 at 17:33:15 (EDT)
I just saw the message you wrote Mr. Stein!!!! GRRRRR!!!
amy 401
NY, NY USA - Wednesday, April 07, 2004 at 17:32:03 (EDT)
oops!
amy 9 401
NY, NY USA - Wednesday, April 07, 2004 at 17:30:33 (EDT)
"HI"
aMY 4o1
NY, NY USA - Wednesday, April 07, 2004 at 17:28:34 (EDT)
Hi Everyone!! You are
enjoying school on your holiday!! Me TOO!
MESSAGES FROM MR. STEIN: YOU
ARE ALL TERRIFIC. I SMILE WHEN I SEE YOUR MESSAGES: TO: Joanne: Thank you
for the compliment. TO: Angela Lambert: Glad you are joining in the fun!
TO DANIEL Z. 6 102: Such pressure!! You can handle anything J, To: ADAM
and MARK G. Can you email me a picture from Colorado? (emaginatorium@aol.com)
Keep it a secret ! TO: Rowena 6 Rachel 5 k011, Remy 5 Taylor 6 k011, keyra5ko14,
Ariel 7 2o2, Alessandro .7.101, marcelo 12 603, lucy gordon, 5 yrs, k011:
YOU ARE WONDERFUL. HAPPY HOLIDAY!!! TO ALL THAT WROTE ME BEDTIME STORIES.
THANKS!!! I AM ACTUALLY SLEEPING BETTER. THE STORIES HAVE HELPED. HAVE
A GREAT VACATION. SEE YOU SOON.
Mr. Stein
USA - Wednesday, April 07, 2004 at 17:23:48 (EDT)
Mr.Stein you are a great computer teacher ever!
joanne,10 402
foresthills, ny USA - Wednesday, April 07, 2004 at 14:13:20 (EDT)
It is so exciting to read all the messages from so many young people
from PS 101 who are on vacation this week. I hope you are having a "fun"
holiday. I really enjoyed the bed time stories....thank you.
Angela Lambert
Flushing, NY USA - Wednesday, April 07, 2004 at 13:24:18 (EDT)
I was absente for ten days!!!! And I have a lot of H.W.!!! And I
will do them today and tommorow and aftertommorow!!!!
DANIEL Z. 6 102
FOREST-HILLS, N.Y. USA - Wednesday, April 07, 2004 at 13:17:54 (EDT)
Hi Mr.stein right now I am in colorado in denver It is 10:53 colorado
time. BYE NOW
Adam G, 8, Class-3-302
Queens, NY USA - Wednesday, April 07, 2004 at 12:55:05 (EDT)
I love my mom and dad and i love the school and my home and my house
and my baby .
Rowena 6 Rachel 5 k011
USA - Tuesday, April 06, 2004 at 19:53:24 (EDT)
I like this school and my home and my frend/s and my mom and dad
and house.
Remy 5 Taylor 6 k011
USA - Tuesday, April 06, 2004 at 19:48:41 (EDT)
mysory
keyra5ko14
USA - Tuesday, April 06, 2004 at 16:13:47 (EDT)
Dear Mr.Stane I am gonna tell you a bedtime story.It is called RED
APPLES.
Ariel 7 2o2
USA - Tuesday, April 06, 2004 at 12:45:30 (EDT)
i dont know.
class 103 i am claribel and i am 6.
i dont know that., USA i dont know. - Tuesday, April 06, 2004 at 12:40:54
(EDT)
I will write you astory.
Alessandro .7.101
Queens, NY USA - Sunday, April 04, 2004 at 19:01:21 (EDT)
kool story u got there. im so bored and i dunno y sunday gotta be
a boring day so i miss skool lil bit and i juss wanna tell my friend i
juss wanna say sup to u k bi
marcelo 12 603
flushing, ny USA - Sunday, April 04, 2004 at 14:59:55 (EDT)
My favorite bed time story is The Lion King.
lucy gordon, 5 yrs, k011
USA - Sunday, April 04, 2004 at 14:08:44 (EDT)
MESSAGE FROM MR. STEIN TO: ALANA 8 2-201- Quite a story!!!:)
Mr. Stein
USA - Sunday, April 04, 2004 at 08:02:29 (EDT)
All you people that haven't yet experienced fifth grade, then I
have something to suggest for fifth grade. ANNOY ANCIENT MAN (MR. LUKE)
AND KEEP TAPPING CRAZILY ON HIS ARM!!!!!!!!!!!!!!!!!!!!!!! Good-bye.
Shunella Class 502 (the class of Ancient Man) 10
Forest Hills, NY USA - Saturday, April 03, 2004 at 15:26:17 (EST)
Once upon a time there was a girl and her father hew could not go
to sleep. So they played twister and other games and they ate food.Soon
the mother woke up and when she got out of bed she sliped on a bannana
peal and landed in sirup because they ate pancakes at one thirty in the
morning.The mother said why are you awake and why is awere daughter still
awake she has school tommorrow. The next day she was drooling on her pillow
then she went to school and drooled on her desk.Then her mom came because
she
forgot her lunch and said her name ten times then her mom remembered she
slep late so then she took her horn out her purse and pressed the horn
four times and her daughter Maria woke up right away THE END
ALANA 8 2-201
USA - Saturday, April 03, 2004 at 13:20:26 (EST)
tOnce upon a time there was a girl and her father hew could not
go to sleep. So they played twister and other games and they ate food.Soon
the mother woke up and when she got out of bed she sliped on a bannana
peal and landed in sirup because they ate pancakes at one thirty in the
morning.The mother said why are you awake and why is awere daughter still
awake she has school tommorrow. The next day she was drooling on her pillow
then she went to school and drooled on her desk.Then her mom came because
she forgot her lunch and said her name ten times then her mom remembered
she slep late so then she took her horn out her purse and pressed the horn
four times and her daughter Maria woke up right away THE END
ALANA 8 2-201
USA - Saturday, April 03, 2004 at 13:19:59 (EST)
MESSAGES FROM MR. STEIN: ***** Special thanks for your messages
to: Laureta L., Andy, 5, K-013, Brian 10 501, TO ALL PS101 Staff, Parents
and Students: ENJOY THE HOLIDAY. I STILL NEED BEDTIME STORIES!!!PLEASE
WRITE SOON. Bye
Mr. Stein
USA - Saturday, April 03, 2004 at 13:03:50 (EST)
Hi! I forgot to write to you well its 8:20 am and at 2:20 im going
to see scooby doo 2. I was just watching Beyblade and just when the good
part was going to happen the show was over. I cant wait to come to computer
again. Because you weren't here yesterday the last day of school. C U Later
BYE!
Laureta L.
forest hills, ny USA - Saturday, April 03, 2004 at 08:21:55 (EST)
Power Ranger Dino Thunder The Dino Rangers used their weapons to
fight the bad guys until they won. After the Dino Rangers won the fight,
the bad guys went to their mysterious home. THE END.
Andy, 5, K-013
Forest Hills, NY USA - Friday, April 02, 2004 at 21:38:31 (EST)
Hey mr.stein you make awesome things for the website. IM always
online in your website
Brian 10 501
ny, newyork USA - Friday, April 02, 2004 at 21:04:40 (EST)
Hey mr.stein you make awesome things for the website. IM always
online in your website
Brian 10 501
ny, newyork USA - Friday, April 02, 2004 at 21:04:21 (EST)
Mr. Stein- IF YOU DECIDE THAT WELL OF SOULS IS APPROPIATE, THEN
PLEASE PUT WELL OF SOULS ON YOUR WEBSITE! Thank u.
Shunella Age 10 Class 502
Forest Hills, NY USA - Friday, April 02, 2004 at 17:56:33 (EST)
This is a wonderful learning environment for students. I want to
make this happen in my school. My school is an early childhood school,
grades K-3. (Third grade is new for 2004-05)I have a computer lab, but
it is a SCANTEK Lab. The funding has run out. This lab concept would be
great for my students. I want to make this happen for 2004-05.
Jacqueline Jones PS 251
Springfield Gardens, NY USA - Friday, April 02, 2004 at 11:17:18 (EST)
I had a terrific time learning in your emaginatorium lab, especially
being taught by K-1-2 students. It's a great educational tool for all students.
Even though my computer teacher has learned a lot from you Mr. Stein, I
am energized to do more with the students in my building. Thank you for
the opportunity. Althea Tyson
Althea Tyson, Principal PS 30 Q
Jamaica, , NY USA - Friday, April 02, 2004 at 11:14:20 (EST)
Rford@nycboe.net
Randolph A. Ford P.S. 131Q
Jamaica Estates, NY USA - Friday, April 02, 2004 at 11:14:08 (EST)
Your demonstration was inspiring. I would like two of my teachers
trained. Please tell me the steps that need to be taken.
Barbara Fuller, PS 116
Jamaica, NY USA - Friday, April 02, 2004 at 11:13:49 (EST)
Send me info about creating a website
Jermaine Garden, Principal P.S. 160
Jamaica, NY USA - Friday, April 02, 2004 at 11:12:27 (EST)
I would like to clone you for my school.
Diane
Hollis, NY USA - Friday, April 02, 2004 at 11:11:38 (EST)
I enjoyed your presentation and I would love to have a great technology
program like this in my school.
Linda Pough, Principal P.S. 52
Queens, NY USA - Friday, April 02, 2004 at 11:10:57 (EST)
The students interest was wonderful
Robert M. Brisbane Principal JHS 231
USA - Friday, April 02, 2004 at 11:10:53 (EST)
Having Fun
Mr. Joseph, Principal P.S. 101
USA - Friday, April 02, 2004 at 10:20:05 (EST)
Hi I am in the computer room
David Erdil LITS
USA - Friday, April 02, 2004 at 08:12:25 (EST)
junie b.jones is a party animal.(Chapter 1) my name is junie b.jones.the
b stands for beatrice. except i don't like Beatrice. I just like b and
that's all. I am almost six years old. Almost six is when you ride the
bus to afternoon kindergarten. My bentest friend named grace rides the
bus with me. Every day she sits right exactly next to me. Cause I save
her a seat, thats why. Saving a seat is when you zoom on the bus. And you
hurry up and sit down. And then you quick put your feet on the seat next
to you. After that, you keep on screaming the word saved,saved,saved and
on one sit next to you. Cause who wants to sit next to a screamer. thats
what I would like to know. Me and that grace have another bentest fried
at school. Her name is Lucille. Lucille does not ride the bus with us.
Her Ritchie nana drives her to school in a big gold car. It is called a
cattier act, I think. and guess what. Today that big gold cattier act was
driving right next to the school bus. I banged on my window very excited.lucille.hey,lucille.it's
me. its junkie b. Jones. I am right next to you on the school bus. See
me see me,lucille.i ma banqueted on my window very excited. Lucille did
not see me.yeah,only here's the problem. your nanna just speeded up her
car.and now you are zooming way ahead of the bus.and so how come i am still
shouting at you. that's what i would like to know.i set down and smoothed
my skirt.lucille's nanna has a lead foot,apparently,i said to grace.lucille's
nanna is rice,she said back.lucille's nanna is very, very rice,i said.
she owns a big,giant house with a million room in it.and she lets lucille's
whole entire family live there.cause it is way too big for just one nanna.wow,said
that grace.i know it is wow,grace,i said.my nanna just owns a plain,old,regular
house,and that's it.that grace did a sad sigh.my nanna just owns a condo
in florida,she said.than me and that grace looked at each other very glum.
our nannas are losers, I said after, we didn't talk the rest of the trip.only
guess what.when we got to school,we saw the nanna's big gold car.it was
parked right in the parking lot.me and that grace runned there speedy fast.lucille.lucille.it's
me.it's junie b. jones.plus also it's that grace.we are running to see
your richie nanna.we opened the door and sticked our heads inside.hi,nanna.said.
hello,nanna.said that grace.thenanna looked surprised at us.yeah,only you
don't even have to be afraid of us,i said.cause we know your grandgirl
very good.plus we won't even harm you.me and thatgrace got in the back.i
rubbed my hand on the seat.Oooo.i lovethis rich velvety interior,i told
her.i put my cheek on it.these seats are ooo-la-la,nanna,i said. Lucile
looked grouchy at me. "Dont call her nanna!" "Lucille!" said the nanna
bery shocked. "whats gotten into you? Your little frinedsare darling."
"Yes, Lucille," i said "I am darling. Plus thatg grace is darling. And
so, back off. Right, Nanna? The nanna did a lud hoot of laughing. "Hey!
You are the freindliest nanna i ever saw!" i said. "And so maybe me and
Grace can come see your richie house sometime." Lucille nanna did another
loud hoot. Then me and Grace did loud hoots, too. And all of us kept pn
laughing and laughing. Only not Lucille.
Valentina Berisha, 8, 2-201
USA - Thursday, April 01, 2004 at 19:55:26 (EST)
I want to show you good night moon.
reona. 6, K-014
USA - Thursday, April 01, 2004 at 16:46:21 (EST)
i like computer class
david 6, k014
USA - Thursday, April 01, 2004 at 10:24:33 (EST)
i like computer class
david 6, k014
USA - Thursday, April 01, 2004 at 10:24:33 (EST)
i like computer class
david 6, k014
USA - Thursday, April 01, 2004 at 10:24:32 (EST)
I want to get the candey cristil eggs
Joshua 5 K -014
New york, NY USA - Thursday, April 01, 2004 at 10:10:05 (EST)
once upon a time a girl and her father could not go to sleep so
they played twister and they had fun the 1st game they first got all tangolled
up and they played and played then they finnally fell asleep THE END
Alana 8 2-201
USA - Thursday, April 01, 2004 at 09:50:56 (EST)
once upon a time a girl and her father could not go to sleep so
they played twister and they had fun the 1st game they first got all tangolled
up and they played and played then they finnally fell asleep THE END
Alana 8 2-201
USA - Thursday, April 01, 2004 at 09:50:55 (EST)
once upon a time a girl and her father could not go to sleep so
they played twister and they had fun the 1st game they first got all tangolled
up and they played and played then they finnally fell asleep THE END
Alana 8 2-201
USA - Thursday, April 01, 2004 at 09:50:55 (EST)
once upon a time a girl and her father could not go to sleep so
they played twister and they had fun the 1st game they first got all tangolled
up and they played and played then they finnally fell asleep THE END
Alana 8 2-201
USA - Thursday, April 01, 2004 at 09:50:55 (EST)
there was a grinch who stole estar eggs at night.Everyone woke up
and got sad.They were looking for there eggs. they found him.
patrisha 8 201
USA - Thursday, April 01, 2004 at 09:50:49 (EST)
Once apon a time a girl burped.The end
Cassandra 7 201
USA - Thursday, April 01, 2004 at 09:50:42 (EST)
i will tell you a scary story. ones there was a boy who lived in
a haunted house.Than one day he saw a room he never saw before.And when
he went in there was a gost.And he was never seen again.
sabrina7201
USA - Thursday, April 01, 2004 at 09:48:53 (EST)
THere once was girL she WAS SLEEPING.AT HER WINDOW SHE HERD somethinG
. shE thouGHT iT was 2 roBERS. but it was .They mADE A PLAIN that there
GOING 2 steel stuFF theRE house .
dENIZ
USA - Wednesday, March 31, 2004 at 20:29:37 (EST)
Wow... I didn't think your twenty questions would know pikachu!
I'm a poke'mon fan. I'm glad my brother, Tim, wrote a story you like. Hopefully,
he'll win. Everyone does. He wants the candy inside. I think the crstal
egg looks nice. I'd like to add it to my collection of jewels. They're
all fragile, though. I keep them from behind me. My regrets, Sam.
Sam,9,303
USA - Wednesday, March 31, 2004 at 15:55:03 (EST)
Thank you for commenting my story. I made it up myself! It helps
me go to sleep all the time! I'm hoping that I'm one of the winners. Sam,
my sister, wanted the egg; I want the candy.
Tim,5,ko12
USA - Wednesday, March 31, 2004 at 15:42:22 (EST)
NESSAGE FROM MR. STEIN: HELLO TO Tim,5,Ko12, GREAT STORY. I WILL
WATCH WHERE I WALK SO THAT I WILL NOT STEP ON THAT SMART ANT. THE CONTEST
ENDS APRIL 18th. THEN I WILL STATE THE WINNER. TO: Sam,9,303: STOP BY THE
COMPUTER LAB. YOU WILL SEE THAT THE MAGIC CRYSTAL BALL WORKS EVERY TIME.
YOU MAY NOT BE DOING THE MATH CORRECTLY. SEE YOU ALL!!!
Mr. Stein
USA - Tuesday, March 30, 2004 at 23:31:58 (EST)
-A nice bedtime story-Thanks
from Mr. Stein
I'm writing you a story. Once,there was a ant who lived in a crack
in a house. Whenever there was a mop, lots of ants got killed. But, this
ant escaped every time the mop came. One day, the ant wanted to take a
stroll. Suddenly, a fat lady blocked the cracks with pavement!The ant couldn't
go in! The ant luckily was able to hide under the couch. He could hear
his friends' pounding on the sticky pavement. Their legs stuck to the cement!
Crawling to a corner, the ant chewed a hole. The ants scattered out! They
made a new hole in the crack. "Thank you!" they all rewarded the brave
ant. They always gave him the biggest share of food; even at winter! Even
now, the eldest are usually the wisest. That's why a lot of food is needed
at winter.... because the brave ant gets the most! The End Did I win?
Tim,5,Ko12
USA - Tuesday, March 30, 2004 at 18:10:59 (EST)
I have a disturbing discovery. Every time I say a number loud, the
"mystery globe" always guessed wrong! Why? You made a disgraceful ball!
My brother and i noticed it. After 19 tries, every answer was completely
differnent. Not even close to the number I said.And I used the same number.
I'm enjoying your website, but you must stop lying. Although I'm only a
student but I'm very disappointed. I've been to California, and used your
website. I asked everyone in the city of your web. No one knew! The web
company said they never heard of your website before! Now, I'll look at
the guestbook messages. Mostly reading mine.
Sam,9,303
USA - Tuesday, March 30, 2004 at 17:52:43 (EST)
ANAglyph pictures look diffrent because you wear the giassesit pops
out.
LEON AND MIKE7
USA - Tuesday, March 30, 2004 at 09:30:32 (EST)
Anaglyph pictures look different because when you where the glasses
it pops out at you.
EILEEN AND LEAH 6, 103
Forest Hills, NY USA - Tuesday, March 30, 2004 at 09:29:34 (EST)
ANAglyph pictures look diffrent because you wear the giasses.
Leon7103
USA - Tuesday, March 30, 2004 at 09:28:32 (EST)
ana glyph pictr are difrent because
Bodhi 103 7
USA - Tuesday, March 30, 2004 at 09:25:48 (EST)
PLEASE WRITE THE ANSWER. HOW ARE ANAGLYPH PICTURES DIFFERENT?
Mr. Stein 103
USA - Tuesday, March 30, 2004 at 09:17:07 (EST)
I like to write a biken with my mommy and my daddy.
Taylor 6 Lindsay 6 k011
USA - Monday, March 29, 2004 at 20:36:49 (EST)
I love to write a bike.
Rowena 6 Rachel 5 k011
USA - Monday, March 29, 2004 at 20:30:14 (EST)
One day a little goblin went by an old cave. It was old,it was cold,it
was dark. And something inside it went bump. What was that? ""Hoo-ooh-"
cried the goblin. He got so scared that he jumped right out of his shoes.
Then he began to run. Pit-pat-pit-pat-pit-pat- What was that? SOMETHING
was running after him. Then when the goblin turned around he saw that his
shoes were the ones following him. I hope I win!!!!!!!!!!
Dalia 6 103
Forest Hills, NY USA - Monday, March 29, 2004 at 19:23:57 (EST)
i like computer
david somar 6 ko14
queens, ny USA - Monday, March 29, 2004 at 19:01:26 (EST)
This is my favorite bed time story : Elowies It is about a girl
who likes to make trouble.
Hannah 7 204
USA - Monday, March 29, 2004 at 17:58:35 (EST)
This is my favorite bed time story is: Elowies It is about a girl
who likes to make trouble.
Hannah 7 204
USA - Monday, March 29, 2004 at 17:57:12 (EST)
ONCE TIME THERES MAN AND THE BOY
KAMAL 29 103
USA - Monday, March 29, 2004 at 16:56:41 (EST)
ONCE TIME THERES MAN AND THE BOY
KAMAL 29 103
USA - Monday, March 29, 2004 at 16:56:37 (EST)
ONCE TIME THERES MAN AND THE BOY
KAMAL 29 103
USA - Monday, March 29, 2004 at 16:56:29 (EST)
HELLO, Mr. stein I loved your web site I always play the new games
that you put. BYE-BYE
Jhostin,12,602
N.Y.C, N.Y USA - Monday, March 29, 2004 at 14:23:09 (EST)
Bill Rocks!
Sarah 10, 501
New York, NY USA - Monday, March 29, 2004 at 10:30:14 (EST)
Name a solid shape!!!!!
Mrs. Harris
USA - Monday, March 29, 2004 at 09:05:42 (EST)
daer Mr stein I like you to hear a story about a girl mane kelly
who did'nt have friend
ester7201
USA - Sunday, March 28, 2004 at 19:34:21 (EST)
daer Mr stein I like you to hear a story bceause a girl mane kelly
who did'nt have friend's
ester7201
USA - Sunday, March 28, 2004 at 19:28:17 (EST)
I will write you a book or a story
Rowena 6 Rowena 5 k011
USA - Sunday, March 28, 2004 at 19:04:05 (EST)
FROM MR> STEIN TO: Hello to Kathy (Kindergarten) I love your story!!!
Mr. Stein
USA - Sunday, March 28, 2004 at 15:43:10 (EST)
I liked the three little
pigs.It is about three pigs who ran away from home they met men who was
carrying things to build houses but there was a wolf who ate the first
and second pigs but the third pig ate the wolf he lived fovrever.
kathy 5 k-013
USA USA - Saturday, March 27, 2004 at 23:38:06 (EST)
My sister and I love your website.We hope you add new things to
the website.
Aleks 9 301
USA - Saturday, March 27, 2004 at 15:20:06 (EST)
HELLO EVERYONE, I HAVE ADDED COLOR AND GRAPHICS FOR GREAT MSSAGES
Mr. Stein
USA - Saturday, March 27, 2004 at 09:18:21 (EST)
my favorite bedtime story is good Night moon.
Noah, 6, k-014
Forest Hills, ny USA - Friday, March 26, 2004
at 20:51:28 (EST)
eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Julia B. 5 K-013
USA - Friday, March 26, 2004 at 18:52:27 (EST)
I put the puzzle you together!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Margaret Chou 9 401
NYC, NY USA - Friday, March 26, 2004 at 17:13:39 (EST)
JAKE JUSTICE IS A POLICE RESCUE HERO. HE IS MY FAVORITE RESCUE HERO.
MICHAEL V. 5 K013
USA - Friday, March 26, 2004 at 16:38:18
(EST)
THE BOY WHO CRIED WOLF
MICHAEL V. 5 K013
USA - Friday, March 26, 2004 at 16:20:57 (EST)
hi whene you win the c omputerdo you win the monitor to
andy 11 503
USA - Friday, March 26, 2004 at 14:32:52 (EST)
I hope i win the free computer and my sister the Easter Egg!
Diana Hou Age 11 Class 503
NYC, NY USA - Friday, March 26, 2004 at 14:30:14 (EST)
POWER RANGERS DINO
ANDY 5
USA - Friday, March 26, 2004 at 09:48:58 (EST)
the boy who
michael v. 5 ko13
USA - Friday, March 26, 2004 at 09:42:16 (EST)
you are sososo cucu
Julia r. 5 k013
USA - Friday, March 26, 2004 at 09:40:16 (EST)
you are sososo cucu
Julia r. 5 k013
USA - Friday, March 26, 2004 at 09:40:15 (EST)
you are sososo cucu
Julia r. 5 k013
USA - Friday, March 26, 2004 at 09:40:14 (EST)
you are sososo cucu
Julia r. 5 k013
USA - Friday, March 26, 2004 at 09:40:12 (EST)
abcdefghijklmnopqrstuvwxyz I love Mrs bedey
sebastian 6 k013
USA - Friday, March 26, 2004 at 09:40:02 (EST)
the boy who.
michael v. 5 ko13
USA - Friday, March 26, 2004 at 09:38:51 (EST)
POWER RANGERS
ANDY 5
USA - Friday, March 26, 2004 at 09:38:42 (EST)
the boy who.
michael v. 5 ko13
USA - Friday, March 26, 2004 at 09:38:14 (EST)
abcdefghijklmnopqrstuvwxyz
Mark 5 k013
USA - Friday, March 26, 2004 at 09:36:36 (EST)
who is youre gril friend.
Julia B. 5 k013
USA - Friday, March 26, 2004 at 09:34:18 (EST)
hello
julia r 5 k013
USA - Friday, March 26, 2004 at 09:25:23 (EST)
I will write my favorite bedtime story, Frog and Toad, to you
Will 6 101
Queens, NY USA - Friday, March 26, 2004 at 08:58:29 (EST)
I will write you a story.
Emily 6 101
USA - Friday, March 26, 2004 at 08:41:13 (EST)
Let me tell you about a story named The Grasshopper and the Ants.The
grasshopper loved doing things.One day he saw ants preparing food.He asked,"Why
are you preparing food?" They said, "Because if we prepare our food now,
we don't have to do it later."The grasshopper thought they were wrong.He
slept and slept.When it winter he had no food left.He asked the ants for
some food.They said they don't have enough for him.He learned his lesson.That
you should prepare food before winter.
Colleen 8 204
USA - Thursday, March 25, 2004 at 21:10:22 (EST)
i WILL TELL YOU STORY CALLED MOLE IN A HOLE
jULIA 5 K-014
USA - Thursday, March 25, 2004 at 20:37:17
(EST)
I will write you a story
Rowena 5 Areta 5 k011
USA - Thursday, March 25, 2004 at 20:13:28
(EST)
I read Sam and Firefly by P.D.Eastman.
keyra, 5, K-014
Forest Hills, ny USA - Thursday, March 25, 2004 at 19:35:05
(EST)
-check the spelling
Thank you for picking me to teaching the prinsabul
Julia B. 5 K-013
USA - Thursday, March 25, 2004 at 18:44:26
(EST)
I like a story about the scary monster. This story is about the
monster and the man.
Kelly 6 102
USA - Thursday, March 25, 2004 at 17:32:42
(EST)
The Ants' Day One day, the ants woke up. The mother ants woke up
there babies. The father ants went to look for food for the queen. They
also took their sons with them. The ants were always looking forward to
please the queen. All the ants took a shower. Then they looked for breadcrumbs
on the streets. Today, some of the ants snook inside somebody's house.
They climbed up the house's wall into the window. They fell into a pile
of what they thought was crystals. One of the ants took a bite of the "crystals."
The ants thought this was so good that they took some for the queen. Next,they
fell into "a big pond"{which was really a sink}.The person who lived there
was about to wash her dishes.She did'nt see the ants,therefore the ants
wtlee sanit though the sewer pipes and into the ocean.They made a little
sailboat out of 3 sticks, a little twig, and a piece of cloth they found
on the ground.It took them three months to finally go home. They missed
when the other ants gave the "crystals" to the queen, but they were made
"honorable ants of the year" a place they thought they would never have!
THE END
Andrea K-103
N.Y., N.Y. USA - Thursday, March 25, 2004 at 16:51:21
(EST)
I really like everything that is here in the Emaginatorium Computer
Lab.
Emma Watson, 13
Jackson Height, NY USA - Thursday, March 25, 2004 at 15:36:37 (EST)
The Boy Who Slept Wolf.It is like a boy That slept when a wolf came.
Claudia 7 204
USA - Thursday, March 25, 2004 at 14:21:04 (EST)
The Boy Who Slept Wolf.It is like a boy That slept when a wolf came.
Claudia 7 204
USA - Thursday, March 25, 2004 at 14:19:36 (EST)
Go to sieep go to sieep Mr.stain
Matthew 7 204
USA - Thursday, March 25, 2004 at 14:13:52 (EST)
Go to sieep go to sieep Mr.stain
Matthew 7 204
USA - Thursday, March 25, 2004 at 14:13:35 (EST)
I know the best good night story and i'm not going to tell you.
??????????
USA - Thursday, March 25, 2004 at 12:59:52 (EST)
Dear, Mr.stine I'm gonna write a nice story for you.
Yasmina 7 102
USA - Thursday, March 25, 2004 at 12:59:19 (EST)
My favorite book is Cosmo's Lemonade Stand.Cosmo put socks in lemonade.
Yoni
USA - Thursday, March 25, 2004 at 12:56:34 (EST)
Hey Mr.Stine i got a good bedtime story
Abigail 6 102
USA - Thursday, March 25, 2004 at 12:56:16 (EST)
please read my book that is cat in the hat.
melissa 6 102
USA - Thursday, March 25, 2004 at 12:55:41 (EST)
I will tell you a DR.Seuss story.
Derek 7 102
USA - Thursday, March 25, 2004 at 12:54:44 (EST)
A bed time story Cosmos lemonade stand. THER WAS A FAIRY TH-AT MADE
LEMONADE BUT HIS LEMONADE WASENT GOOD AND THE GOOD ENGRIDIANT WAS SOCK.
Borja 6 102
USA - Thursday, March 25, 2004 at 12:54:05 (EST)
bed time storys. scooby-doo 2 only on march26 coming in ferdrs.
its about monstrs and the gange.
jonathan8102
USA - Thursday, March 25, 2004 at 12:53:32 (EST)
Thanks Mr.Stein for looking at Well of Souls. Shunella says thanks
too. [Confucious say: Feed the Pug]
CJ, 10, 502
Forest Hills, NY USA - Thursday, March 25, 2004 at 12:49:37 (EST)
please read my story it is the cat in the hat
melissa 6
USA - Thursday, March 25, 2004 at 12:46:33 (EST)
bed time storys. scooby-doo 2 only on march26 coming in ferdrs.
its about monstrs and the gange.
jonathan8102
USA - Thursday, March 25, 2004 at 12:42:30 (EST)
bed time storys. scooby-doo 2 only on march26 coming in ferdrs.
its about monstrs and the gange.
jonathan8102
USA - Thursday, March 25, 2004 at 12:42:27 (EST)
I love the boy who that call wolf
kelly 6 class
USA - Thursday, March 25, 2004 at 12:41:29 (EST)
My favorit story is The Lion King.
jaelah 7 102
USA - Thursday, March 25, 2004 at 12:35:44 (EST)
I will write you a story at home.
Justin 6 102
USA - Thursday, March 25, 2004 at 12:35:38 (EST)
i will write a story
Lala 6 102
USA - Thursday, March 25, 2004 at 12:20:35 (EST)
ilike you i am going to giv you abed time i wil help you siep thikbotdlvins
sylvie 5 ko14
USA - Thursday, March 25, 2004 at 10:32:03 (EST)
ilike you i am going to giv you abed time i wil help you siep thikbotdlvins
sylvie 5 ko14
USA - Thursday, March 25, 2004 at 10:32:01 (EST)
ilike you i am going to giv you abed time i wil help you siep thikbotdlvins
sylvie 5 ko14
USA - Thursday, March 25, 2004 at 10:32:00 (EST)
ilike you i am going to giv you abed time i wil help you siep thikbotdlvins
sylvie 5 ko14
USA - Thursday, March 25, 2004 at 10:31:59 (EST)
ilike you i am going to giv you abed time i wil help you siep thikbotdlvins
sylvie 5 ko14
USA - Thursday, March 25, 2004 at 10:31:58 (EST)
Hello
Mr. Stein 6 ko14
USA - Thursday, March 25, 2004 at 10:31:53 (EST)
i gotoshowgoodnghrmoon
reonako14
USA - Thursday, March 25, 2004 at 10:24:57 (EST)
I want to tell you a story called the pot of gold
sunny 6 k-014
USA - Thursday, March 25, 2004 at 10:23:37 (EST)
i like the three little kitns
rachel 6 k014
USA - Thursday, March 25, 2004 at 10:20:02 (EST)
i like the three little kitns
rachel 6 k014
USA - Thursday, March 25, 2004 at 10:20:00 (EST)
i like the three little kitns
rachel 6 k014
USA - Thursday, March 25, 2004 at 10:19:58 (EST)
i like the three little kitns
rachel 6 k014
USA - Thursday, March 25, 2004 at 10:19:56 (EST)
I LIKE PLAYING IN THE PARK
JIYUNG 5 K014
USA - Thursday, March 25, 2004 at 10:19:18 (EST)
I will tell Mr stine a bedtime story its calld The popcorn poper
Joshua 5 k014
New york, NY USA - Thursday, March 25, 2004 at 10:19:00 (EST)
i will tell you a story clled good night moon
noah 6 k014
USA - Thursday, March 25, 2004 at 10:00:53 (EST)
Once upon a time there was a boy in a forest that was called falcon
forest. When he was walking he saw a glowing wolf and it looked like it
was nice but it was was mean. So the boy ran and ran as fast as he could
and five ours later the police checked the falcon forest and found the
dad wolf and captured it. bye
Granit Class 201
Forest Hills, ny USA - Thursday, March 25, 2004 at 09:50:56 (EST)
there was a grinch that stole food from everybody.Then one day when
he treied to steel food from he was caught.
melannie 8 201
USA - Thursday, March 25, 2004 at 09:49:35 (EST)
Frog and toad all year
kyra 7 201
n.y USA - Thursday, March 25, 2004 at 09:49:07 (EST)
Once upon a time there was the grimple old man. He was so angry
that the cradren run away . But one cild was on the tree . and two years
later the cild was gone .but the cild still happy. and the grimple old
man died but he was happy
amane 8 201
USA - Thursday, March 25, 2004 at 09:44:22 (EST)
i love my compture teacher because..... i like my computer teacher
because he is fun.i like the fun games he plays.i like his funny toys.i
like how he teaches us to play games on the computer.
lauren 7 201
USA - Thursday, March 25, 2004 at 09:38:59 (EST)
Ilove granit.
Bianca C.7 202
USA - Thursday, March 25, 2004 at 09:37:41 (EST)
Ilove granit.
Bianca C.7 202
USA - Thursday, March 25, 2004 at 09:37:40 (EST)
tHIS STORY IS ABOUT MIKEY HE AND HIS FRIENDS DID NOT WANT TO GO
TO SLEEP . THEY PLAYED PILLOW FIGHT YA GOT YOU! HA HA! AND THEY NERER WENT
TO SLEEP THE END.
oLIVIA 201 8
USA - Thursday, March 25, 2004 at 09:35:36 (EST)
i love the games
valentina,8,2-201
USA - Thursday, March 25, 2004 at 09:35:23 (EST)
Cute
I am going to make up my own story it is gona be grat yoiill see
oh pleas beillev me oh pleeeeeaaass weii by iguss THANKYOU LOVEYOUBY
Bianca C. 8
USA - Thursday, March 25, 2004 at 09:09:10 (EST)
Iam going to tell you a bedtime stoRY
Alexis 7 202
USA - Thursday, March 25, 2004 at 09:00:56 (EST)
I will tell you a bedtime story.
Anna Maria 7 2-202
USA - Thursday, March 25, 2004 at 09:00:45 (EST)
I will tell you a bedtime story. Once there lived a boy who was
poor. The wind blew on the poor boy. He said"Stop wind stop'Then the boy
fell asleep.GOOD NIGHT!
Maya 7 202
USA - Thursday, March 25, 2004 at 08:59:44 (EST)
Cyndrella bigfoot I will tell you a story.
moe 8 202
USA - Thursday, March 25, 2004 at 08:57:17 (EST)
I AM GOWING TO TELL YOU ABOUT THE FISH WHO WANED TO MAIRY
jacklyn 7 202
USA - Thursday, March 25, 2004 at 08:57:11 (EST)
I'm going to tell you about Bell And The Magic miorra Diary
maria 8 202
USA - Thursday, March 25, 2004 at 08:55:27 (EST)
-Perhaps Mommy and Daddy
will buy you one soon.
I am sorroy that I can not do You story because I dont have a cumpeter
Natthinee 9 202
USA - Thursday, March 25, 2004 at 08:55:18 (EST)
ll you about a story
Alexis 7 202
USA - Thursday, March 25, 2004 at 08:51:51 (EST)
I am going to tell you a bedtime story. It is called Mark and ARIEL
THE DRAGONS.
Mark & Ariel class202 7&7
USA - Thursday, March 25, 2004 at 08:51:42 (EST)
I will tell you Mr.Stein about Cinderella.
Gabriel 6 202
USA - Thursday, March 25, 2004 at 08:48:01 (EST)
Hi,Mr.Stien!
Anna Maria 7 2-202
USA - Thursday, March 25, 2004 at 08:46:23 (EST)
I will tell you a bedtime story. the ugle duckling.
isabella 7 202
USA - Thursday, March 25, 2004 at 08:44:59 (EST)
iwill write abot batman and rabbit
brian 7 202
USA - Thursday, March 25, 2004 at 08:41:47 (EST)
i will write you a story
remy 6 k-011
USA - Thursday, March 25, 2004 at 07:45:10 (EST)
i will write you a story
remy 6 k-011
USA - Thursday, March 25, 2004 at 07:45:09 (EST)
i will write you a story
remy 6 k-011
USA - Thursday, March 25, 2004 at 07:45:09 (EST)
i will write you a story
remy 6 k-011
USA - Thursday, March 25, 2004 at 07:45:09 (EST)
i will write you a story
remy 6 k-011
USA - Thursday, March 25, 2004 at 07:45:06 (EST)
i will write you a story
remy 6 k-011
USA - Thursday, March 25, 2004 at 07:45:02 (EST)
MESSAGES FROM MR. STEIN TO: Shunella and C.J of class 502. I will
look at Well of Souls. Thanks for sharing your thoughts.
Mr. Stein
USA - Thursday, March 25, 2004 at 05:45:56 (EST)
Himpelchen und Pimpelchen Das ist der Daumen, der schuttelt die
Pflaumen, der hebt sie auf, der tragt sie nach Haus und der kleine isst
sie alle, alle auf! translation: This is the tumbken this one shakes the
plums this one picks them up this one brings them home and the little guy
eats them all by his/her self.
Natalie 7 101
USA - Wednesday, March 24, 2004 at 19:56:01
(EST)
MY favorite book is GOERGE and MARTHA.
SAM 5 K014
USA - Wednesday, March 24, 2004 at 19:53:09
(EST)
i like this vedo. I like this video
Rachel 5 k011.
forest hills, ny USA - Wednesday, March 24, 2004 at 18:33:55
(EST)
Once a girl went to sleep.She had a good time sleeping.She had a
good dream.That is how she went to sleep.
Mikhael 7 201
NYC, NY USA - Wednesday, March 24, 2004 at 17:59:10
(EST)
happy mr stin.
Andy 5 K-013
USA - Wednesday, March 24, 2004 at 17:32:48
(EST)
I ma gun rit a story for you.
Areta 5 k-011
USA - Wednesday, March 24, 2004 at 09:39:55 (EST)
iwilrityou astory
lucy 5ko11
USA - Wednesday, March 24, 2004 at 09:39:40 (EST)
iwilrityouastory
pranav 5ko11
USA - Wednesday, March 24, 2004 at 09:39:17 (EST)
iwilrityou astory
lucy 5ko11
USA - Wednesday, March 24, 2004 at 09:38:05 (EST)
iwilrityouastory
pranav 5ko11
USA - Wednesday, March 24, 2004 at 09:37:02 (EST)
Ther was a Girl her name was Taylor. She was in bed and she had
a horse in her room.She playd in her room in her dreems.The end
Taylor 6 k-011
USA - Wednesday, March 24, 2004 at 09:36:18 (EST)
I like this moveing.
Rachel 5 ko11
USA - Wednesday, March 24, 2004 at 09:33:14 (EST)
i will write a story
connorand 5 christian5andconnor5ko11 o c
USA - Wednesday, March 24, 2004 at 09:31:23 (EST)
i will write you a story
Rowena 5 k011
USA - Wednesday, March 24, 2004 at 09:28:29 (EST)
I will rite you a story.
Taylor 6 k-011
USA - Wednesday, March 24, 2004 at 09:22:44 (EST)
i will write you a story.
Lucy 5 k011
USA - Wednesday, March 24, 2004 at 09:11:43 (EST)
I want to enter the bedtime story contest.
Joshua 5 014
NYC, NY USA - Tuesday, March 23, 2004 at 21:08:47 (EST)
I want to enter the bedtime story contest.
Jessica 7 203
NYC, NY USA - Tuesday, March 23, 2004 at 21:01:45 (EST)
Batman and Mr. Freeze Mr Freeze was a brilliant scientist. But he
became a bad guy, and he used his ice gun to ice people. But Batman stoped
him, and put him into jail. A big robot took him out, and the other bad
guy Walker want him to freeze the whole world. Batman and Robin found them,
and destroyed their plan.
Kevin, 6, K013
Forest Hills, NY USA - Tuesday, March 23, 2004 at 20:23:33
(EST)
I like movies.
Kevin, 6, K013
Forest Hills, NY USA - Tuesday, March 23, 2004 at 19:47:42
(EST)
1 WRITE A STORY ABOUT MEN AND THE BOY
KAMAL 6 103
USA - Tuesday, March 23, 2004 at 18:31:05
(EST)
i like real pokemon.
wenyi
new york, USA - Tuesday, March 23, 2004 at 18:26:29
(EST)
There are too many entries for that bedtime contest. Tim didn't
finish his entry.. he had computer today? Scott, are you reading this like
last time?
Sam,9,303
USA - Tuesday, March 23, 2004 at 18:12:28 (EST)
I have the best bedtime story...it goes like this.... Once upon
a time the light went on.... the end
Crazy and lazy kid
USA - Tuesday, March 23, 2004 at 13:29:20 (EST)
I am going to
Timothy 5 k-012
USA - Tuesday, March 23, 2004 at 11:12:57 (EST)
hi
Eliza6k
USA - Tuesday, March 23, 2004 at 11:12:48 (EST)
I tell you a story.
Evalena 6 k-012.
USA - Tuesday, March 23, 2004 at 11:08:01 (EST)
egg
michelle 5 k-012
michelle, USA - Tuesday, March 23, 2004 at 11:07:29 (EST)
I HAD LOTS OF BOOKS IM WILL READ YOU ONE
ISABELLA
USA - Tuesday, March 23, 2004 at 11:03:29 (EST)
I will tell you a story.
Anthony 5 k012
USA - Tuesday, March 23, 2004 at 10:44:10 (EST)
I WANT A CRISTAL EGG, YOU ARE NICE.
NATALIE 6 103
USA - Tuesday, March 23, 2004 at 09:34:02 (EST)
I will write a story about a man and a boy. Mom will help.
kamal 6 103
USA - Tuesday, March 23, 2004 at 09:33:01 (EST)
The story is about a girl named Dora and a monkey named Boots they
were going to make a wish but a rock hit the star out of the sky and Dora
got the star back in the sky. The story is about a girl named Dora and
she has a monkey
EILEEN AND LEAH 6, 103
USA - Tuesday, March 23, 2004 at 09:32:34 (EST)
I like your websits I like it because they are fun
waylon 6 103
new york, USA - Tuesday, March 23, 2004 at 09:26:21 (EST)
I don't want to enter the contest
Frank 6 103
USA - Tuesday, March 23, 2004 at 09:23:10 (EST)
I want to enter the contest.
Paulina 6 103
USA - Tuesday, March 23, 2004 at 09:23:02 (EST)
I went to the website. See you soon, Mr. Stein.
michael v. 5, ko13
forest hills, ny USA - Monday, March 22, 2004 at 21:45:57
(EST)
I like the part when the motorcycles were stuck in a ball. [in a
round clear ball]
kathy 5 k-013
USA - Monday, March 22, 2004 at 19:45:13 (EST)
I want to enter the contest please. My favorite bed time story is
Spooky Stories by Barnes & Noble books. It's a little scary but it
scares me to sleep.
Alex R, 7 years old, class 203
Forest Hills, NY USA - Monday, March 22, 2004 at 18:42:32
(EST)
I like the hoilday surprise.Thankyou Mr.Stein
keyra5k'014
Foresthills, ny USA - Monday, March 22, 2004 at 18:07:34
(EST)
DUCKONCE OPON A TIME IS IT
KAMAL CLASS103
QWEENS, NYC USA - Monday, March 22, 2004 at 18:03:18
(EST)
sleeping beauty is my favorite story. this story is about a beautiful
girl named sleeping beauty. then one day a handsome prince came and kissed
her then she woked up. THE END
HELENA 7 1/2 203
USA - Monday, March 22, 2004 at 12:54:46 (EST)
sleeping beauty is my favorite story.
HELENA 7 1/2 203
USA - Monday, March 22, 2004 at 12:40:20 (EST)
Chick Wont Go to Sleep is my favorite story.
DINA ,7 ,203
USA - Monday, March 22, 2004 at 12:39:02 (EST)
I will enter the contest.
kevin 7 203
Ij USA - Monday, March 22, 2004 at 12:35:58 (EST)
I want to enter the contest, please.
Elise,7,203
USA - Monday, March 22, 2004 at 12:28:25 (EST)
I do not want to enter the contest.
Hassan 8 203
USA - Monday, March 22, 2004 at 12:18:35 (EST)
Hey Mr.Stien it's my birtday so im going to chill with my friends
today we are going to go to the movies and eat lunch i will see you on
Monday.
Bahar 11 501
NewYork, NY USA - Monday, March 22, 2004 at 10:13:08 (EST)
I am going to write Mr.Stein a story. The story is about a boy and
his dad.They are bald.The boy wanted to do everything at the same time.
Paulina 6 103
NY USA - Monday, March 22, 2004 at 09:07:55 (EST)
Hi fellow 101-ers, I hope this year is going well for all of you.
I absolutely love my class this year but I miss all my children who have
moved up.
Mrs. Harris teacher 103
USA - Monday, March 22, 2004 at 09:07:27 (EST)
My story was about a boy who cryed wolf.
NATALIE 6 103
USA - Monday, March 22, 2004 at 09:04:30 (EST)
i will read a bed time story
claribel 6 class 103
USA - Monday, March 22, 2004 at 09:04:02 (EST)
My story is about tree bars have sope a litil red riding hod eats
the sope.
Dalia 6 103
USA - Monday, March 22, 2004 at 09:03:53 (EST)
m
NATALIE 6 103
USA - Monday, March 22, 2004 at 08:55:47 (EST)
I am going to write mr stien a story.
Leah 6 103
NY USA - Monday, March 22, 2004 at 08:53:27 (EST)
I will write Mr. Stein a story.
Paulina 6 103
USA - Monday, March 22, 2004 at 08:46:11 (EST)
MESSAGES FROM MR. STEIN**** Hello Kathy 5 k-013* Write and tell
me what you liked best about the circus ***TO: Daniel .t. 6 102, I am fine.
Thank you for asking. **TO Alicia 7, 204: WHich game do you like the best?
TO: Sakura 7 204: Ask Mom or Dad for help. I cannot find the missing man
either. TO SONYA 503, Would you recommend the movie to me or to other students.
Write about it here. TO Lauretta Save your picture to disk. Pmaybe we can
post it to the website. BYE EVERYBODY SEE YOU SOON, Mr. STEIN
Mr. Stein
USA - Monday, March 22, 2004 at 06:28:10 (EST)
FROM
MR. STEIN- CONTEST NOTICE
A CONTEST FOR ALL K, 1 and 2 GRADERS. CAN YOU WRITE YOUR FAVORITE
BEDTIME STORY HERE? YOU MAY WIN A CRYSTAL CANDY EGG. SEE THE WEBSITE FOR
DETAILS. ENJOY
Mr. Stein
USA - Sunday, March 21, 2004 at 20:52:44 (EST)
When I woke and thought of Fairytales There was light above my head
In shapes of mischief That cannot be received today The Moons all circle
on beside of me Charon came inside my head To live and dream and share
Instead of Orbiting his planet like he should Miranda had begun to flirt
as Luna hid behind her skirt That universe began to melt away Melt Away
melt away
Mr. Klein, Age 33, P.S. 134
Hollis, NY USA - Sunday, March 21, 2004 at 20:49:27 (EST)
Dear Mr. stein, All your games are really fun!
Alicia 7 2-204
USA - Sunday, March 21, 2004 at 19:17:24 (EST)
Your the best at teaching computer class.I went to see a movie called
AGENT CODY BANKS 2,it was a great movie.BYE BYE.
Sonya,503,10
Queens, ny USA - Saturday, March
20, 2004 at 21:40:32 (EST)
how are you going.
Daniel .t. 6 102
USA - Saturday, March 20, 2004 at 12:30:55 (EST)
I cannot find the missing man.
Sakura 7 204
USA - Saturday, March 20, 2004
at 10:59:17 (EST)
I like the website mr. stein.
kathy 5 k-013
USA - Friday, March 19, 2004 at 21:17:43 (EST)
I like the website mr. stein.
kathy 5 k-013
USA - Friday, March 19, 2004 at 21:17:42 (EST)
I like computer
kathy 5 k-013
USA - Friday, March 19, 2004 at 21:10:48 (EST)
I like computer
kathy 5 k-013
USA - Friday, March 19, 2004 at 21:10:44 (EST)
I went to the circus last night. It is the greatest show on earth.
I liked it so much.
Kathy 5 k-013
USA - Friday, March 19, 2004 at 21:04:41 (EST)
I went to the circus last night. It is the greatest show on earth.
Kathy 5 k-013
USA - Friday, March 19, 2004 at 21:00:05 (EST)
I went to the circus last night. It is the greatest show on earth.
Kathy 5 k-013
USA - Friday, March 19, 2004 at 20:59:29
(EST)
I Love You Mr. Stein
kathy 5 k013
USA - Friday, March 19, 2004 at 20:41:20 (EST)
i love you mr. stein
kathy 5 k013
USA - Friday, March 19, 2004 at 20:34:10 (EST)
Dear Mr. Stein, Tomorrow I'm going to ask Mrs. Grossman if I can
give you something. It will be a surprise. Love,Justin
Justin 102
USA - Thursday, March 18, 2004 at 21:18:28 (EST)
Hello Mr.Stein its laureta I just wanted to say hi and I drew the
winter picture i hoppe you like it. well see you 2morrow. Bye!
Laureta L,10,503
Forest Hills, ny USA - Thursday, March 18, 2004 at 20:50:05 (EST)
Thanks for the instructions to do this Mr. Stein.
Mrs. Bodenstein, 3-303
USA - Thursday, March 18, 2004 at 19:37:52 (EST)
Mrs.Grossmery she told me I was wonderful in Ally Pond.
Daniel Z. 6 102
Forest Hills, NY USA - Thursday, March 18, 2004 at 19:21:35 (EST)
Mr. Stein can we please download mavis beacon typing lesson in our
computer ... please put the downloading thing in your website ... and please
respond to me as soon as possible
Sandy
Forest Hills, USA USA - Thursday, March 18, 2004 at 18:37:21 (EST)
I can read what it on the top"Fill in the blanksbelom to add to
our guestbook.Please,for safetysake,NO PERSONAL INFORMATOIN.The only blank
that MUST fill in are the comments and name section.Please include your
age,class or relationship withP.S.101.We are collecting messages from around
the globe.Students are acknowledged when someone leaves a message to them,from
a far away place.IF you are a visitor from far away,place write yourname
and relationship to the P.S.101 student(s)to whom you are writing.Thanks!
Mr.Stein,Computer Lab Teacher and WebMaster
Daniel Z. 6 102
USA - Thursday, March 18, 2004 at 17:50:56 (EST)
I like your things that you find on your cool website.
Daniel Z. 6 102
USA - Thursday, March 18, 2004 at 17:07:10 (EST)
I like fathers day
Jessica 6 203
New yrok, NY USA - Thursday, March 18, 2004 at 10:26:05 (EST)
Check the spelling!!
i lost my tuoth yestr day
rachel 6k rachel 6 k014
USA - Thursday, March 18, 2004 at 10:25:52 (EST)
Check the spelling!!
i like compude
david 6 ko14
USA - Thursday, March 18, 2004 at 10:22:55 (EST)
I have a really fun website!
Julia 5 k-014
USA - Thursday, March 18, 2004 at 10:22:32 (EST)
I like aqurium
Joshua 5 K=O14
New yrok, NY USA - Thursday, March 18, 2004 at 10:21:39 (EST)
I like to play hide and seek.
sunny 6 k-014
USA - Thursday, March 18, 2004 at 10:18:51 (EST)
ilikegaboy
reonaokuda
USA - Thursday, March 18, 2004 at 10:12:34 (EST)
i like computer
Sam 5 k014
USA - Thursday, March 18, 2004 at 10:02:45 (EST)
MESSAGES TO:Mrs. Bodenstein, Teacher- Welcome to the world of technology
at P.S. 101. Congrtulations to Kats as well for winning the treat.
Mr. Stein
USA - Thursday, March 18, 2004 at 05:50:35 (EST)
Kats congrats!! Your guess wins you a prize
Mrs. Bodenstein, Teacher
USA - Wednesday, March 17, 2004 at 23:17:11 (EST)
Mrs.Bodenstein.Is your birthday March 17 or 18.
Jean L.,8,303
USA - Wednesday, March 17, 2004 at 21:05:49 (EST)
Mrs.Bodenstein.Is your birthday March 17 or March 18.
Jean L.,8,303
Forest Hills, NY USA - Wednesday, March 17, 2004 at 21:01:51 (EST)
Is it March 17 or 18!?!
scott, 8, 303
forest hills, NY USA - Wednesday, March 17, 2004 at 20:47:47 (EST)
I played soda straw and went to the soda zoo!
Daniel 8 201
New York City, NY USA - Wednesday, March 17, 2004 at 19:00:29
(EST)
Hi Mr.Stein! Have a Happy Saint Patties Day! (Patricks)
Hannah Spiro, 10, 501
Forest Hills, NY USA - Wednesday, March 17, 2004 at 18:34:45 (EST)
Dear Mrs. Bodenstein, I didn't know your message was here! Were
you born on August6? I'm not sure if this is the exact date. Can I guess
again? Uhh... October 9? Mine's an obvious guess. ( Near my mom's birthday.)
Sam,9,303
Forest Hills, NY USA - Wednesday, March 17, 2004 at 16:56:07
(EST)
hi mr. Stein I wanted to play your games but i couldnt because i
mom didnt let me go on the computer sorry well cya tommorow
justin 7 204
NY USA - Wednesday, March 17, 2004 at 16:37:03 (EST)
Well, I don't know for sure, but my guess is between March 15 and
March 20. Please tell me if I'm correct.
Kats T., 8, 303
Ny, Ny USA - Wednesday, March 17, 2004 at 15:16:56 (EST)
Forget it.
Kats T.,8,303
ny, ny USA - Wednesday, March 17, 2004 at 15:14:28 (EST)
You must write your name and your guess on the guestbook in order
to win the treat.
Jan Teacher 303
USA - Wednesday, March 17, 2004 at 12:56:56 (EST)
Be the one of the first five to answer this question. Get a treat!!!!!
When is my birthday?
Jan Teacher 303
USA - Wednesday, March 17, 2004 at 12:55:45 (EST)
hello mr. stein i did it almost
Jan Teacher 303
USA - Wednesday, March 17, 2004 at 12:54:16 (EST)
hello students write me a message.
Jan Teacher 303
USA - Wednesday, March 17, 2004 at 12:51:51 (EST)
MESSAGES FROM MR. STEIN: To: Tenaya, 10, 503. Thank you for showing
the website to your mother last night. If she wants blending for kindergarteners,
tell her to try Zac he Rat. There are many phonics lessons with word blending.
**** HELLO TO THE FOLLOWING STUDENTS THAT VISITED THE WEBSITE LAST NIGHT**
**michael v., 5, k013**Granit**Laureta L.,10,503 and Jessica B. 302 8
Mr. Stein
USA - Wednesday, March 17, 2004 at 06:07:40 (EST)
i went to the website
michael v., 5, k013
USA - Tuesday, March 16, 2004 at 20:06:15 (EST)
i went to the website
michael v., 5, k013
USA - Tuesday, March 16, 2004 at 20:06:00 (EST)
hi.IM right behind you
Granit
Forest Hills, NY USA - Tuesday, March 16, 2004 at 19:35:57 (EST)
hi.IM right behind you
Granit
Forest Hills, NY USA - Tuesday, March 16, 2004 at 19:35:53 (EST)
hi mr. stein im right behind you see you later. ok bye! I had fun
on your computer!
Laureta L.,10,503
forest hills, ny USA - Tuesday, March 16, 2004 at 19:34:10 (EST)
I am on the website.
Jessica B. 302 8
USA - Tuesday, March 16, 2004 at 19:19:42 (EST)
to mr. stein my mother wanted to know how to get a specific educational
program for kindergarten and blending out words. if you know can you notify
me in class 503 please
tenaya, 10, 503
jamaica, ny USA - Tuesday, March 16, 2004 at 18:44:28 (EST)
My Dad is going to figure out the missing man. He will write the
message here. Hahahahahahaha
Arnost 8 302
USA - Tuesday, March 16, 2004 at 18:22:04 (EST)
Dear Mr.Stein,
Grace 101 6
Forest Hills, N.Y. USA - Tuesday, March 16, 2004 at 15:44:58 (EST)
hi.
matthew 9 class 302
USA - Tuesday, March 16, 2004 at 14:53:54 (EST)
hi i am matthew.i love computer.
matthew 9 class 302
USA - Tuesday, March 16, 2004 at 14:52:49 (EST)
HI Mr.Stien i like the shellgame alot!
Jennifer ,12, 602
Forest Hills, Ny USA - Tuesday, March 16, 2004 at 14:42:48 (EST)
xhghgxchjgascyfshjuegwfuigg
omi 303
USA - Tuesday, March 16, 2004 at 14:07:15 (EST)
mrsteinruintabeach?
Sandy, 7
USA - Tuesday, March 16, 2004 at 10:22:15 (EST)
We're bored. We're going to the coloring book. We just found a dusty
post-it looking like an index card. Aaaaaaa---chhoo!!
Reiko & 3318
USA - Monday, March 15, 2004 at 10:55:52 (EST)
I liked the optical illution sitr it ids RADDDD!!
Sarah, 10 501
New York, NY USA - Monday, March 15, 2004 at 10:27:31 (EST)
Mr. Stein,I saw the optical illusions and i loved it!
Austin,10,501
Forest Hills, NY USA - Monday, March 15, 2004 at 10:26:37 (EST)
Catrina viewed educational
videos at home!!! (United Streaming
I saw fables Mr. Stein
Catrina, 6, 101
Forest Hills, NY USA - Sunday, March 14, 2004 at 21:12:08
(EST)
MESSAGES FROM MR. STEIN ------ To: YONI 6 102 - Boy you get up early!
Glad you are using the school website. ------ To: Gaby 6 101 - What fable
did you watch? Did you show it to Mommy or Daddy? ---- I am so Proud of
You!!!
Mr. Stein
USA - Sunday, March 14, 2004 at 08:17:05 (EST)
I liked the optical illusions.
YONI 6 102
USA - Sunday, March 14, 2004 at
07:23:12
(EST)
I went to fable Mr.Stein.I liked it a lot.
Gaby 6 101
USA - Saturday, March 13, 2004
at 19:22:09 (EST)
FROM MR. STEIN HELLO TO: Julia 5 k-014 Does your fish have a name?
I have a parrot named Honey!!! I enjoy your messages Emily K-014 I am happy
you like the website. Can you color a picture online and print it for me?
Matthew 7 204 Matthew has ants in his pats too! aleks 502 Save the brochure
file as your student number ***brochrefront and ***brochureback and bring
it to school. Perhaps we can print it in school. Yujin 9 402 After you
make the soda straw geometric figure, hit print screen. Open MSWord, write
your name etc. and select edit paste. Now print it. YOU ARE ALL DOING GREAT.
YOU MAKE ME PROUD.
Mr. Stein
USA - Saturday, March 13, 2004 at 14:17:26 (EST)
Do you have a real pet I do it is a fish
Julia 5 k-014
USA - Saturday, March 13, 2004 at 13:45:12 (EST)
I have a new toy and my sistet has three cute toys
Julia 5 k-014
USA - Saturday, March 13, 2004 at 13:38:23 (EST)
Do you have a new website?
Julia 5 k-014
USA - Saturday, March 13, 2004 at 13:30:38 (EST)
I have a toy that my friend gave me
Julia 5 k-014
USA - Saturday, March 13, 2004 at 13:23:48 (EST)
I love your website Mr.Stein. I go on the website every time.
Emily
Forest Hills, NY USA - Saturday, March 13, 2004 at 08:27:56 (EST)
mr.stin has ants in hes pants
Matthew 7 204
USA - Friday, March 12, 2004 at 22:15:34 (EST)
hi Mr.Stein i tryed to print the brochure it wont come up could
you show me how to put it on my computer
aleks 502
USA - Friday, March 12, 2004 at 19:06:05 (EST)
hi!!!! i made a soda straw but couldn't print it.
Yujin 9 402
Forest Hills, NY USA - Friday, March 12, 2004 at 10:20:43 (EST)
MR.
JULIA B. 5 K-013
USA - Friday, March 12, 2004 at 09:48:23 (EST)
MR. STEIN IS SILLY
JULIA 5 K-013
USA - Friday, March 12, 2004 at 09:48:18 (EST)
I have a big siser!
Julia 5 k-014
USA - Thursday, March 11, 2004 at 18:08:09 (EST)
I DID SODA STRAW AND IT WAS SO FUN.
ISABELLA 7 202
USA - Thursday, March 11, 2004 at 08:50:36 (EST)
Hello K011, K012, K013. Did anyone color in the paint picture from
home? If you did, show it to me tomorrow.
Mr. Stein
USA - Wednesday, March 10, 2004 at 21:34:51 (EST)
I was at the computer workshop. All I can say is WOW!!!!
Sharon
Floral Park, NY USA - Wednesday, March 10, 2004 at 13:41:16 (EST)
What a wonderful site and so much fun! I would love to work with
you on Friday. See you then.
Angela Lambert
Flushing, NY USA - Wednesday, March 10, 2004 at 13:31:10 (EST)
I am happy that some of our kindergarteners and first graders are
showing movies to their parents from their home computer. WOW!
Mr. Stein
USA - Wednesday, March 10, 2004 at 06:28:16 (EST)
I watch the movie and I showed it to mom and dad and my sister and
I laked it.
Leah 103
USA - Tuesday, March 09, 2004 at 21:11:58 (EST)
I watch the movie and I showed the movieto my mom and Dad and my
sister and I laked it.
Leah 103
USA - Tuesday, March 09, 2004 at 21:09:52 (EST)
I go to 4 websites!
Julia 5 k-014
USA - Tuesday, March 09, 2004 at 18:51:50 (EST)
I wanted to say hi and you are the bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeessssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssttttttttttttttttttttttttttttttttttttttttttttttt
teacher ever. So now do I get a 4+ or a 4 for that.
Melissa10501
New York, NY USA - Tuesday, March 09, 2004 at 18:35:59 (EST)
i like the movie
sebastian 6 k-012
USA - Tuesday, March 09, 2004 at 10:49:19 (EST)
isabella 7 202
USA - Monday, March 08, 2004 at 18:47:54 (EST)
WEWATCH MOVIE
KAMAL
USA - Monday, March 08, 2004 at 17:29:53 (EST)
I saw a movie on the website
Leah 6, 103
USA - Monday, March 08, 2004 at 08:52:10 (EST)
Hi Everyone. Please do not write cute messages from movie stars.
Only write messages using your first name, age and class. Thanks and Enjoy!!
From Mr. Stein
USA - Monday, March 08, 2004 at 00:33:56 (EST)
mr stein i have to ask u a question
duke
USA - Sunday, March 07, 2004 at 18:52:27 (EST)
Can you send me a message?
Julia 5 k-014
USA - Sunday, March 07, 2004 at 17:50:18 (EST)
i made an invention1 and it worked
Catherina 11 602
new york, Newyork USA - Sunday, March 07, 2004 at 15:14:56 (EST)
_____ MESSAGES FROM MR. STEIN ----- To: Julia 5, K014 You are SO
Smart!! Your messages are wonderful. I want more! To: Tony 6, class 101
What movie did you show your Mom. Did she like it? I am proud of you! To:
Catrina, 6, 101 Hillary Duff is NOT coming! To Ryan Lee, 10 We all remember
you. Glad you came back to visit the site after you graduated. Try Soda
Straw. Let us know if you like it.
MR. STEIN -Webmaster
USA - Sunday, March 07, 2004 at 13:01:27 (EST)
I like sundays!
Julia 5 k-014
USA - Sunday, March 07, 2004 at 12:42:29 (EST)
I have a sister!
Julia 5 k-014
USA - Sunday, March 07, 2004 at 12:37:48 (EST)
hello mr. westerland's class, its me Ryan I hope you remember me.
Ryan Lee, 10
long island, ny USA - Sunday, March 07, 2004 at 11:12:44 (EST)
Educational videos on
Sunday AM with Mom!
Hi Mr.Stine I show the vede to my Mom
tony class 101
new york, USA - Sunday, March 07, 2004 at
07:28:29 (EST)
i like to drink from my baby sisters bottle
laryn,12,304
bronx, ny USA - Saturday, March 06, 2004 at 14:29:11 (EST)
Hi! my name is linda im Lauretas cousin and I live in Pehlam Parkway
Bronx. I want to go to your school. I might be moving to forest hills.
I hope i do and i really wan to go to my cousins computer class. I hope
i could meet the computer teacher. Bye!
Linda A.,8,grade 3
new york, ny USA - Saturday, March 06, 2004 at 14:13:27 (EST)
Do you no how to get to my house?
Julia 5 k-014
USA - Saturday, March 06, 2004 at 14:02:24 (EST)
Do you no how to get to my house
Julia 5 k-014
USA - Saturday, March 06, 2004 at 14:02:07 (EST)
Do you have a kid?
Julia 5 k-014
USA - Saturday, March 06, 2004 at 12:09:33 (EST)
I wish I had a pokemon toy!
Julia ,5, k-014
USA - Saturday, March 06, 2004 at 12:04:45 (EST)
You are the computer teacher.You teach us good stuff.You tell us
good stories on the computers.I hope you like your job. Love, xena
xena 5 k-013
forest hills,113, N.Y. USA - Saturday, March 06, 2004 at 08:44:44 (EST)
CONGRATULATIONS to the students below. They went home on Friday
and watched educational movies by going to our website. They even left
me messages. Boy you're SMART. Some students are just 5 years old!!!!!
You make teaching a delight! I am so proud of you!!! Julia 5, K013, Michael
5 k013, Laureta L.,10,503
Mr. Stein
USA - Saturday, March 06, 2004 at 01:02:17 (EST)
Hi, I am in Orlando, Florida. It is ve3ry hot here.
Mark, 10, 503
Orlando, FL USA - Friday, March 05, 2004 at 21:59:47 (EST)
Dear Mr. Stein I loved and my mom loved the moves.
Emily W. 6 101
USA - Friday, March 05, 2004 at 19:08:00 (EST)
Hey Mr. Stein the videos work on my computer im getting ready to
go to manhattan because 2morrow is my moms B-Day so we g2g buy her something
ok Bye!
Laureta L.,10,503
Forets Hills, ny USA - Friday, March 05, 2004 at 18:01:44 (EST)
Go to my website
julia 5
USA - Friday, March 05, 2004 at 17:48:27 (EST)
I can go to your website
julia 5
USA - Friday, March 05, 2004 at 17:39:34 (EST)
i love to watch tv
julia 5
USA - Friday, March 05, 2004 at 17:35:15 (EST)
i like the soda game
michael 5 k013
USA - Friday, March 05, 2004 at 09:39:58 (EST)
Hey Grandpa and Gandma. How's it going??
Jolijt T./501/11
Queens, Ny USA - Friday, March 05, 2004 at 07:41:42 (EST)
I like the moon.I love the sun.I love my class
Rowena 5 Rachel 5 k011
USA - Thursday, March 04, 2004 at 19:05:44 (EST)
I LIYKT TEH CULRIG BOOK .
JULIA 5 K-013
USA - Thursday, March 04, 2004 at 17:25:33 (EST)
The soda straw is great.
Claudia 7 204
USA - Thursday, March 04, 2004 at 14:24:21 (EST)
Yo & Kats Grandparents Aloha from Hawaii. We are impressed with
your home page, links and activities. Its been cold in the mornings this
week, between 65 and 70 degree. Have a nice day, Take care, Give everyone
an extra HUGG, Love and miss you Grandma/Grandpa
Happy & Kats Tamanaha
Honolulu, HI USA - Thursday, March 04, 2004 at 13:42:23 (EST)
i love aviel
shira102
USA - Thursday, March 04, 2004 at 12:43:07 (EST)
iloveyou mr.stine
mikk 6 102
USA - Thursday, March 04, 2004 at 12:40:52 (EST)
i love mr.stine
hana 6 102
USA - Thursday, March 04, 2004 at 12:38:28 (EST)
Hi Mom. I love you
Claire 6 102
USA - Thursday, March 04, 2004 at 12:21:52 (EST)
I like the aquairim
Joshua 5 k014
New york, NY USA - Thursday, March 04, 2004 at 10:31:56 (EST)
I like the move
Joshua 5 k014
New york, NY USA - Thursday, March 04, 2004 at 10:29:09 (EST)
i love pokemon
sunny 6 k o14
USA - Thursday, March 04, 2004 at 10:25:19 (EST)
i like the big tv.
rachel 5 in 11/12 k014
USA - Thursday, March 04, 2004 at 10:19:32 (EST)
i like te movie
keyra 5 k014
USA - Thursday, March 04, 2004 at 10:12:26 (EST)
I am the Aunt of Jolite Tamanaha, a P.S. 101 student. I am her father's
older sister; however, not much older!
Mrs. Lani Tamanaha Broadbent
Grasonville, MD USA - Thursday, March 04, 2004 at 09:33:35 (EST)
Has anyone played an educational video for their parents?
Mr. Stein
USA - Wednesday, March 03, 2004 at 21:21:05 (EST)
Hello kids
Mr. Stein
USA - Wednesday, March 03, 2004 at 21:19:57 (EST)
can I have the movia please?
kelly m.95-25-72 ave.102
USA - Monday, March 01, 2004 at 17:36:56 (EST)
Yes Lauretta.... I know Granit is your brother. Say Hi to all the
boys in the family. See you at school. Ciao
Mr. Stein
USA - Sunday, February 29, 2004 at 21:51:20 (EST)
Mr.stein i just realized that you wrote a message that included
me and my brother granit. you new he was my brother didn't you? Ill get
all the answers on friday.
Laureta L.,10,503
Forest hills, ny USA - Sunday, February 29, 2004 at 17:43:06 (EST)
Hey mr.stein how r u well im fine. I just came back from the park
i played alot of basketball oh yea do you think that mr.joseph will let
the 6th grade have a basketball match at the end of the year instead of
volleyball. Tell me when i come to your class on friday. Bye!
LauretaL.,10,503
Forest hills, ny USA - Sunday, February 29, 2004 at 17:35:39 (EST)
TR is Teddy Theodore Roosevelt, 26th president of the United States.
He was at the train station in Forest Hills.
Jean L.,8,303
Forest Hills, NY USA - Sunday, February 29, 2004 at 11:14:13 (EST)
Hi Everyone, Glad to see you are using the website. A special hello
to Lauretta for doing all the string art pictures. CONGRATULATIONS Also
hello to Granit. Please write your age and class so we all know how old
you are. You are doing very well. See You All Monday. Mr. Stein
MR. STEIN
USA - Sunday, February 29, 2004 at 09:37:58 (EST)
hi mr. stein my score for the gecko shuffle is 30460 i'll see you
on friday and i'll show you!!
Tenaya, 10, 503
Jamaica, ny USA - Saturday, February 28, 2004 at 23:43:38 (EST)
Hey! I just finished all of my homework and im watching Disney Channel
right now lizzie mcGuire is on. I've been on the web site all day and got
in trouble for staying so long. Well, Bye!
Laureta,10,503
Forest Hills, ny USA - Saturday, February 28, 2004 at 19:40:42 (EST)
bahar is so hot so do not holla at here because she is crazzy
sunny 15 603
ny, ny USA - Saturday, February 28, 2004 at 13:09:30 (EST)
bahar is so hot so do not holla at here because she is crazzy
sunny 15 503
ny, ny USA - Saturday, February 28, 2004 at 13:08:50 (EST)
Hi mrs. stine i go on your website every day.I like the games.ther
so cool. see you next thursday
Granit
new york, NY USA - Saturday, February 28, 2004 at 11:39:48 (EST)
Hi mrs. stine i go on your website every day.I like the games.ther
so cool. see you next thursday
Granit
new york, NY USA - Saturday, February 28, 2004 at 11:39:47 (EST)
Hi mrs. stine i go on your website every day.I like the games.ther
so cool. see you next thursday
Granit
new york, NY USA - Saturday, February 28, 2004 at 11:39:42 (EST)
Hi mrs. stine i go on your website every day.I like the games.ther
so cool. see you next thursday
Granit
new york, NY USA - Saturday, February 28, 2004 at 11:39:39 (EST)
Hi! i just found out there is a guessing game on the web. Well,
im getting ready to go to BJ's and buy some new clothes. So again ill see
you on monday. Bye!
Laureta L. 10, Class 503
Forest Hills, ny USA - Saturday, February 28, 2004 at 10:26:20 (EST)
Hi Mr.Stein! I have been doing all the string pictures i finishes
every single one. I printed them then on friday you could see.They look
so cool. My favorite one is the rectangle and box. Well see you again on
friday! Bye!
Laureta L. 10,class 503
Forest Hills, ny USA - Saturday, February 28, 2004 at 00:16:21 (EST)
hey mr stein your web site is the best. see you on monday. bye
Brian 10 class 501
nyc, new york USA - Friday, February 27, 2004 at 21:41:57 (EST)
HI!! mister stein I love computer class
jaime
USA - Thursday, February 26, 2004 at 17:03:55 (EST)
HMMMNMGKL HJ5NTJKFMK ;UNI;L .IBVFVSCDXUWYJER 7WUIDTUYEVY
HJKJHUKKURRKIJHNYI
USA - Thursday, February 26, 2004 at 13:00:10 (EST)
i love you
nandini5k-011
USA - Wednesday, February 25, 2004 at 09:59:55 (EST)
Mr.stein a kid named sam called you a fraud. You should tell that
kid to go to your room talk to him/her and prove their wrong.
Jordan K. 8 301
USA - Wednesday, February 25, 2004 at 07:47:02 (EST)
Mr. stein is it true that you used to work at russel stage and used
to help my nany Mrs.Powers. Tell me when ever you see me. From,jordan
Jordan Knight 8 301
USA - Tuesday, February 24, 2004 at 21:06:40 (EST)
Hey Mr.Stein, how r u? I have been on the website alot. Ill see
you on friday Bye!
Laureta,10,503
Forest Hills, ny USA - Tuesday, February 24, 2004 at 19:02:21 (EST)
h
h
h, h USA - Monday, February 23, 2004 at 19:51:37 (EST)
hi mr. stein i didnt have time to show my mom the graph i had to
play video games with my mom
justin 7 204
kew gardens, ny USA - Monday, February 23, 2004 at 18:59:25 (EST)
I think computer is cool because you can do whatever you want like
play, working and doing lots of things. Ithink is funny too because you
sometimes you find fun things to do and funny things too.
Mario
cartagena, Colombia - Monday, February 23, 2004 at 14:32:59 (EST)
HI HI HI HI HI HI HI HI HI HI HI HI HI HI HI HI HI okay i quit...
bye bye bye bye bye bye bye bye bye bye bye bye bye bye bye bye bye bye
IM BORED
Patricio
NY, USA - Monday, February 23, 2004 at 14:32:12 (EST)
You can change your life (If you wanna) You can change your clothes
(If you wanna) If you change your mind Well that's the way it goes But
I'm gonna keep your jeans And your old black hat ('Cuz I wanna) They look
good on me You're never gonna get them back At least not today Not today
Not today, 'cuz If it's over let it go and Come tomorrow it will seem So
yesterday So yesterday I'm just a bird That's already flown away Laugh
it off Let it go and When you wake up it will seem So yesterday So yesterday
Haven't you heard that I'm gonna be okay You can say you're bored (If you
wanna) You can act real tough (If you wanna) You could say you're torn
But I've heard enough Thank you You've made my mind up for me When you
started to ignore me Do you see a single tear It isn't gonna happen here
At least not today Not today Not today, 'cuz If it's over let it go and
Come tomorrow it will seem So yesterday So yesterday I'm just a bird That's
already flown away Laugh it off Let it go and When you wake up it will
seem So yesterday So yesterday Haven't you heard that I'm gonna be okay
If you're over me, I'm already over you If it's all been done, What is
left to do How can you hang up,If the line is dead If you walk out, I'm
a step ahead If you're movin' on, I'm already gone If the light is off,
Then it isn't on At least not today Not today Not today, 'cuz If it's over
let it go and Come tomorrow it will seem So yesterday So yesterday I'm
just a bird That's already flown away Laugh it off Let it go and When you
wake up it will seem So yesterday Haven't you heard you're so (yesterday)
If it's over let it go and Come tomorrow it will seem So yesterday So yesterday
I'm just a bird That's already flown away Laugh it off Let it go and When
you wake up it will seem So yesterday So yesterday Haven't you heard that
I'm gonna be okay
matty
USA - Monday, February 23, 2004 at 14:29:16 (EST)
I did your Crystal Ball, and it kept doing the wrong symbols! Your
thing isn't working! Fraud...........
Sam
USA - Monday, February 23, 2004 at 11:10:40 (EST)
We think that the man in the picture is Theodore Roosevelt
Jean L. + Teresa H.
Forest Hills, NY USA - Monday, February 23, 2004 at 11:08:05 (EST)
Look at the frauds under us! They copied!
Unknown
USA - Monday, February 23, 2004 at 11:01:55 (EST)
We both know where TR was He was in P.S.101Q Garden, and I think
he's Teddy Roosevelt.
Samantha+Reiko
Queens, NY USA - Monday, February 23, 2004 at 10:59:15 (EST)
I WENT SKIING FOR THREE DAYS IN ALL DIFFERENT PLACES IN UPSTATE
NY.
jolijt/11/5
Queens, NY USA - Monday, February 23, 2004 at 10:31:45 (EST)
HEY MR.Stien how are you well i am fine?Yesterday i watched Bad
boys 2 it was mad funny.I also watched Dady DAY Care that was ok to.Bye
see ya on Mon!!!
BaharA.11501
Queens, USA USA - Monday, February 23, 2004 at 10:26:16 (EST)
Hey mr. Stein i saw you got servered 2 times and it is still good.
I also saw barader shop 2 it was alright but i liked the first one. Well
bye 1
Maya W. 11 501
Queens, NY USA - Monday, February 23, 2004 at 10:20:09 (EST)
i saw babershops on saturday night
Cecile 11 501
qunnes, ny USA - Monday, February 23, 2004 at 10:19:49 (EST)
This message is for MIKE 7 103 Wierd Movie is in downloads on the
front page. Enjoy it!! Leave me a message if you download it to desktop
and make it work from home. I am proud of you!!! Bye
Mr. Stein- Teacher
USA - Sunday, February 22, 2004 at 21:05:14 (EST)
can you please put the weird moive on pretty please. Do you have
enough messages?
MIKE 7 103
FOREST HILS, NY USA - Sunday, February 22, 2004 at 18:17:25 (EST)
Hi everyone! I am in Mexico. It is very hot here. The ocean's waves
are very big here too.
Harrison 7 101
USA - Saturday, February 21, 2004 at 23:50:04 (EST)
Hi! I'm in Hawaii.
Samantha 7 204
Honolulu, HI USA - Saturday, February 21, 2004 at 14:11:41 (EST)
I just saw "50 first dates". It was rated pg-13.
Susan 9 402
Forest Hills, NY USA - Saturday, February 21, 2004 at 11:48:58 (EST)
hello mr stein i hope you enjoyed your vacation thanks for helping
my mom with the web site and invitations see you next week
jaclyn 7 201
kew gardens, ny USA - Friday, February 20, 2004 at 21:51:32 (EST)
Hey, Mr. Stein! I found that website I was telling you about, that
you might want to put it on yours. It is: http://sodaplay.com/constructor/index.htm
I hope you are having a good vacation! (ps I didn't know if I was suposed
to put in the place I am staying at for vacation, so I just put Queens)
:D
Jeremy Lyon Freedberg ,P.S. 101,11, 502
Queens, NY USA - Friday, February 20, 2004 at 17:57:41 (EST)
mr.stein i hop you had a good vacation
jacklyn 7 202
USA - Friday, February 20, 2004 at 11:03:37 (EST)
I am in my moms and dads work.and when i leave i am going to see
confessions of a teenage drama queen it is the oppning day.
sabrina 7 201
USA - Friday, February 20, 2004 at 10:22:03 (EST)
I am in my moms and dads work.
sabrina 7 201
USA - Friday, February 20, 2004 at 10:17:06 (EST)
I had a nice VACATION!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
KellyF. , 6,102
Forest Hills, NY USA - Thursday, February 19, 2004 at 15:44:47 (EST)
HEY MR.STIEN YOU GOT MY MESSAGE WELL WHEN WERE SKING WE GET A HOTEL
AND WE GET A POOL GOOD-BY MR.STIEN
Abigail 6 102
New York, USA - Wednesday, February 18, 2004 at 12:11:53 (EST)
On Tusday we wentto see Cheaper by the dozen.We are staying at my
Grandparent's house.
derek 7 102
williamsburg, VA USA - Tuesday, February 17, 2004 at 20:02:48 (EST)
Hi Mr. Stien I am now in Las Angeles,California.
Samantha ,9,402
ny, ny USA - Tuesday, February 17, 2004 at 13:04:31 (EST)
HI MR.STEIN.
Isabella H. 7 202
USA - Tuesday, February 17, 2004 at 10:35:56 (EST)
HI MR.STEIN.
Isabella H. 7 202
USA - Tuesday, February 17, 2004 at 10:35:42 (EST)
Hello to Jennifer,12,602 I am Fine. Vacation is WONDERFUL. Hope
you are enjoying yours!!
From Mr. Stein
USA - Monday, February 16, 2004 at 20:54:45 (EST)
Hi how are you mr.stein
Jennifer,12,602
ForestHills, NY USA - Monday, February 16, 2004 at 20:02:59 (EST)
I'm going to Florida and I'm going to have a lot of fun!!! And the
city that I'm going to is Miami!!!
Daniel Z. 6 102
USA - Monday, February 16, 2004 at 08:28:59 (EST)
I'm in vail Colorado and i'm skiing
Megan,7,201
Vail , Colorado USA - Sunday, February 15, 2004 at 15:59:35 (EST)
Hi everyone! I am going to Florida tomorrow! Hope everyone has a
great president's week!
Olivia 12 602
Forest Hills, NY USA - Sunday, February 15, 2004 at 13:03:38 (EST)
Hello Everyone. I am in BOston MA at the science museum. I just
saw a show on electricity Bye
Mr. Stein and Rosa
USA - Sunday, February 15, 2004 at 12:31:19 (EST)
The cristal was wrong.
JessicaB 8 302
USA - Sunday, February 15, 2004 at 11:00:33 (EST)
I am not going to Florida but I am going sking. Hope you had a nice
ValentinesDay good-by Mr.Stien.
Abigail 6 102
Forest Hills, NY USA - Sunday, February 15, 2004 at 09:34:29 (EST)
i am tenayas sister and on stretch mr. Joseph he looks crazy!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Tamia5
Jamaica, ny USA - Saturday, February 14, 2004 at 18:28:48 (EST)
Thank you for being my friend.I am at home.Have a good Presidents
week.
Yoni 6 1/2 102
F.H., NY USA - Saturday, February 14, 2004 at 15:50:30 (EST)
Anna Maria (7) 202. Hello Anna Maria, Daddy has given me another
way to speak to you.., and how much easier it will be now!I hope are well?and
being agood girl,I think of you so much and hear from your Daddy,that you
are studying hard,(good girl)Did you get my present? that I sent you recently?
I hope so!Jenny asked after you, when I saw her Last Wednesday She says
to say "Hello" next time I could, So this is a good opertunatity to do
so!I have read some of the e-mails sent to your class There are so many
it must be exciting for you all! Maybe, you can send a message to me in
return I will say bye bye for now and finish my ironing Love you lots xxxx
Grandma Peggy
Peggy (Grandmother)
Forest Hills, NY USA - Friday, February 13, 2004 at 16:43:10 (EST)
Hello Anna Maria, Daddy has given me another way to speak to you..,
and how much easier it will be now!I hope are well?and being agood girl,I
think of you so much and hear from your Daddy,that you are studying hard,(good
girl)Did you get my present? that I sent you recently? I hope so!Jenny
asked after you, when I saw her Last Wednesday She says to say "Hello"
next time I could, So this is a good opertunatity to do so!I have read
some of the e-mails sent to your class There are so many it must be exciting
for you all! Maybe, you can send a message to me in return I will say bye
bye for now and finish my ironing Love you lots xxxx Grandma Peggy
Peggy
Forest Hills, NY USA - Friday, February 13, 2004 at 16:39:13 (EST)
dear mr. stan i like the movie.
sebastian 6 k-012.
forest hills, ny USA - Friday, February 13, 2004 at 16:12:17 (EST)
youarethebestcomputerteacherever!
joanne 10 402
foresthills, ny USA - Friday, February 13, 2004 at 10:27:41 (EST)
MR.STRSTIYN I RILE LIYK YOU LOVE JULIA B.
JULIA B. 5 K-013
USA - Friday, February 13, 2004 at 09:39:39 (EST)
MR.STRSTIYN I RILE LIYK YOU LOVE JULIA B.
JULIA B. 5 K-013
USA - Friday, February 13, 2004 at 09:39:36 (EST)
Hello again. Keep up the great work. I am proud of you all!
Mr. Stein
USA - Thursday, February 12, 2004 at 23:23:06 (EST)
Cograts Deniz! You were the first to make the coloring book work
at home!
Mr. Stein
USA - Thursday, February 12, 2004 at 23:14:07 (EST)
Hi Everyone, Please leave messages during the vacation.
Mr. Stein - Teacher
USA - Thursday, February 12, 2004 at 23:12:32 (EST)
To all the teachers at PS101,just wanted to say thank you for the high
level of education you are giving to my daughter Anna Maria(202) at times
Anna astounds me with what she has learnt and i am very very proud of her,here
in the UK the education our children recive is no where near as high as
in the USA,thankyou so much again and best wishes to all the staff and
children,hope to one day meet some of you personally.dale
Dale(parent)32
london, UK - Thursday, February 12, 2004 at 10:17:17 (EST)
To my little princess Anna Maria 7 (202) missing you lots darling and
cant wait to see you which will be soon i hope,ill call you tonight darling,fell
asleep last night thats why i didnt call,sorry! must be getting old (dont
agree)heres a question for you Anna what continent is Tunisa in??? tell
me your answer later and no cheating,love you lots and lots and miss you
more xxxxx
dale(parent)32
london, UK - Thursday, February 12, 2004 at 10:13:06 (EST)
Hi! Hi!class 102 happy Valentines day and a nice vacation.
Kelly F. 6 102
Forest Hills, NY USA - Wednesday, February 11, 2004 at 19:15:40
(EST)
Hi! Hi!class 102 happy Valentines day and a nice vacation.
Kelly F. 6 102
Forest Hills, NY USA - Wednesday, February 11, 2004 at 19:14:43
(EST)
Dear Mr.Stein I LOVE YOU MR.Stein.
Kelly F. 6 102
Forest Hills, NY USA - Wednesday, February 11, 2004 at 19:07:37
(EST)
Hi. Hi. Hi.
Amy 9
NY, NY USA - Wednesday, February 11, 2004 at 17:49:33 (EST)
Hi.
Amy 9
NY, NY USA - Wednesday, February 11, 2004 at 17:48:21 (EST)
Hi.
Amy 9
NY, NY USA - Wednesday, February 11, 2004 at 17:48:19 (EST)
Hi.
Amy 9
NY, NY USA - Wednesday, February 11, 2004 at 17:48:15 (EST)
Hi.
Amy 9
NY, NY USA - Wednesday, February 11, 2004 at 17:48:12 (EST)
Hi.
Amy 9
NY, NY USA - Wednesday, February 11, 2004 at 17:48:08 (EST)
Hi.
Amy 9
NY, NY USA - Wednesday, February 11, 2004 at 17:48:02 (EST)
I'm dying here! HELLO!!!!!!
Shunella 10 502
Forest Hills, NY USA - Wednesday, February 11, 2004 at 10:41:06
(EST)
I'm suffering from Mr. Luke's ancientness! Somebody...help...me...........
Shunella 10 502
Forest Hills, NY USA - Wednesday, February 11, 2004 at 10:40:03
(EST)
Professor Stein, I was unabled to attend today's class because I have
the flu. I have been feeling horrible with fever, body ache, sore throat
and an endless headache. Following my doctor's advice I stayed home trying
to recuperate. I'll bring a copy of my doctor's letter to the next class.
22zElizabeth
New York, NY USA - Tuesday, February 10, 2004 at 22:46:18 (EST)
Dear all the teachers of P.S. 101, Thank you for everything you taught
us. You're all great teachers. We miss you so much,teachers in Indonesia
are very different. And how are you? We really hope you're fine. Please
reply to us: mata5watt@yahoo.com Farra and Tamara
Tamara (8), farra (12)
Banjarmasin, Kal-Sel Indonesia - Tuesday, February 10, 2004 at 06:09:44
(EST)
Hi!!!!! I miss 101 so much!!! JHS is a lot harder, because you have
to do things like memorize the Preamble of the Constitution. I hope you
guys have fun!! MR. STEIN IS THE COOLEST!!!!!!!!!!! GO MR. STEIN!! By the
way this is Sarah his favorite student. (No joke)
Sarah 12 703
Forest Hills, NY USA - Monday, February 09, 2004 at 19:49:34 (EST)
How do I gey the things you have on paint if I don't have what you
have?
Harrison 6 101
USA - Monday, February 09, 2004 at 18:38:02 (EST)
dear mr stan i like the movie.
sebastian 6 k-012.
new york, USA - Monday, February 09, 2004 at 15:37:04 (EST)
Hello! I have to do my lessons with my friend, Reiko. We're not thrilled
on memorizing maps!
Samantha 9
Forest Hills, NY USA - Monday, February 09, 2004 at 10:53:37 (EST)
Mr. Daniel Stein, Hello! I know you from the Tuesday train ride. I
FINALLY logged on to your wonderful website. Quite impressive!!!! I'll
see you soon on the LIRR.
Ms. Albert
USA - Sunday, February 08, 2004 at 15:50:12 (EST)
DearMr.Stein, I finished the shell game!!!!!!!!!!!!!!!!!!!!!!!!!!!
Maya 7 202
USA - Sunday, February 08, 2004 at 11:44:10 (EST)
i am in New Jersey
Ivan.S. 9 401
USA - Sunday, February 08, 2004 at 11:11:59 (EST)
i am in New Jersey
Ivan.S. 9 401
USA - Sunday, February 08, 2004 at 11:11:58 (EST)
Mr.Stian Happy valentine's Day.
Daniel .t. 6 102
USA - Saturday, February 07, 2004 at 22:23:13 (EST)
pleas put the move. I will be good every day.
Daniel .t. 6 102
USA - Saturday, February 07, 2004 at 22:15:11 (EST)
HI. YE WOULD LIKE TO SAY HI TO ALL YE PEOPLE WHO IS ON YE INTERNET
ON SATURDAY 4:55 FEBRUARY 7. BYE. YE WOULD LIKE TO SAY BYE TO ALL YE PEOPLE
WHO WAS ON YE INTERNET SATURDAY 4:56 FEBRUARY 7. BYE.
SHUNELLA 10 502
FOREST HILLS, NY USA - Saturday, February 07, 2004 at 16:56:34 (EST)
YE SEE THAT NO ONE BUT YE IS WRITING YE STUPID MESSAGES. IS YE YE ONLY
ON YE INTERNET?
SHUNELLA 10 502
FOREST HILLS, NY USA - Saturday, February 07, 2004 at 16:53:28 (EST)
If ye want to hear ye story, listen closely... There once was ye pickle.
YE END. Did ye like ye story? If ye think ye too short, ye meant it to
be ye way. Ye will continue writing ye very short stories if ye wish to
hear more. KUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPOKUPO!!!!!!!!!
Shunella 10 502
Forest Hills, NY USA - Saturday, February 07, 2004 at 16:51:16 (EST)
Dark...evil...
Shunella Lumas 10 502
Forest Hills, NY USA - Saturday, February 07, 2004 at 16:42:03 (EST)
I got to the 10th level on shell game.
Megan,7,201
Forest Hills, NY USA - Saturday, February 07, 2004 at 12:16:48 (EST)
I got to the 10th level.
Megan,7,201
Forest Hills, NY USA - Saturday, February 07, 2004 at 12:12:48 (EST)
I got to the 10th level in shell game.
Megan, 7, 201
Forest Hills, NY USA - Saturday, February 07, 2004 at 12:08:16 (EST)
I got to the 10th level in shell game
Megan, 7, 201
Forest Hills, NY USA - Saturday, February 07, 2004 at 12:07:53 (EST)
I ALSO DOWNLOADED THE SPIRAL ON MY COMPUTER.
SUSAN 9 402
FOREST HILLS, NY USA - Saturday, February 07, 2004 at 09:08:45 (EST)
I ALSO DOWNLOADED THE SPIRAL ON MY COMPUTER.
SUSAN 9 402
FOREST HILLS, NY USA - Saturday, February 07, 2004 at 09:08:44 (EST)
Hi Mr.Stien, I'm back from Pennsylvania.
Michelle 401
Forest Hills, New York USA - Friday, February 06, 2004 at 21:41:48
(EST)
I beat the score at shellgame contest!!!!!!!!!!!!!!!!!!!!
Yang Y./7/class302
Forest Hills, Ny USA - Friday, February 06, 2004 at 21:07:53 (EST)
Dear Mr.Stein Happy Valentines Day.
Kelly F. 6 102
Forest Hills, NY USA - Friday, February 06, 2004 at 17:49:16 (EST)
HI MR.STEIN
ISABELLA 7 CLASS 202
USA - Friday, February 06, 2004 at 17:00:19 (EST)
HI MR.STEIN
ISABELLA 7 CLASS 202
USA - Friday, February 06, 2004 at 16:59:58 (EST)
Hi Mr.Stein I think that on the website you should put a little typing
place where you can type in something you are looking for. For example
I was looking for the spiral just now nad couldn't find it, so if you put
a little area on top of the website that we can type something we are looking
for in it would be easier. Well thats it see you on Friday!
Gizem, 9, 402
Forest Hills, NY USA - Friday, February 06, 2004 at 15:58:04 (EST)
Hy Mr.Stein, My cousine says that she hates her shcool. She says when
it rains they have to stay in the lunch room and eat there lunch but after
that they have there lunch they have to stay inside and they have to site
there and talk so be happy for wqaching your movies here at P.S101
Lauren 10 503
forest hills, ny USA - Friday, February 06, 2004 at 14:32:30 (EST)
Hi Mr Stien i am enjoying your computer class.Thanks
Sonya 10 503
Forest Hills, ny USA - Friday, February 06, 2004 at 14:31:49 (EST)
Hi Mr.Stein, my cousin, Shoshi heard about your website. I told her
all about your computer lab. She would really like to see your lab. She
says shes gonna' e-mail you!!!!!!!!!
Emily 10 503
Forest Hills, NY USA - Friday, February 06, 2004 at 14:31:43 (EST)
Hey ya Miss Sawicky and PS101! Greetings from the capitol of Croatia!!
Diana Lovrin, 22
Zagreb, Croatia - Friday, February 06, 2004 at 14:30:27 (EST)
I want to be a dog for Halloween. Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi
Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi Hi
Stephanie, 10, 503
New York City, ny USA - Friday, February 06, 2004 at 14:30:13 (EST)
Join my group S.M.P. very cool club. YEAH!!!!!!!!!!!!!!
Haolong 11 603
Ny, USA - Friday, February 06, 2004 at 13:54:19 (EST)
S.M.P JOIN OUR NEW GROUP S.M.P TO HELP PEOPLE
StefanPHI
Ny, USA - Friday, February 06, 2004 at 13:40:57 (EST)
S.M.P JOIN OUR NEW GROUP S.M
StefanPHI
Ny, USA - Friday, February 06, 2004 at 13:40:18 (EST)
hi
kathy
USA - Thursday, February 05, 2004 at 21:52:41 (EST)
this is for shirley lu
shi wen xuan
beijing, China - Thursday, February 05, 2004 at 20:19:48 (EST)
DearMr.Stein, I like our Computer lesson.It is so funny.
kelly F. 6 ,102.
forest hills, ny USA - Thursday, February 05, 2004 at 18:18:30 (EST)
I miss you. Thank you for teaching me how to get to your website.
ryan simmons 5 k012
reston, va USA - Thursday, February 05, 2004 at 16:51:05 (EST)
HI mr.Mushroom your name is weard.I love your computer room.The stuff
on the computers are great.I like FARY EGGS.
Yoni 6 102
USA - Thursday, February 05, 2004 at 13:00:53 (EST)
Dear Mr.Stien, I figured out a way to get the ball into the cup with
a spring from Invention Playhouse. Love, Justin
Justin 6 102
USA - Thursday, February 05, 2004 at 12:49:52 (EST)
Hello to Miss. Sawicki and all of the children in her class. This is
a great project and I hope you get tons of emails! Enjoy the rest of the
school year! -Cathy Sciame, Seaford, NY-
Cathy Sciame
Seaford, NY USA - Thursday, February 05, 2004 at 12:49:22 (EST)
Hi Mom, Happy Birthday The class says hi Love me
Brian K 202
USA - Thursday, February 05, 2004 at 09:04:57 (EST)
I like the third game because it almost got hypnotized.
Daniel Z. 6 102
USA - Thursday, February 05, 2004 at 07:41:53 (EST)
I am the brother of a former teacher in your school. I live in California,
but I am currently in India for business. If you have questions for me
you can email me at hmcohen@hotmail.com and I will try to provide some
answers. Hope this helps your cause. I was told to "Just note in the email
that you are "Mrs. Ariel Miller's brother" so they get the connection."
Howard Cohen, 34, N/A
Dehli, India - Thursday, February 05, 2004 at 02:07:21 (EST)
To Everyone at P.S.101, I miss you all so much and wish I could see
you all soon. Come visit me in Las Vegas!!! Love, Mrs. Ariel Miller
Mrs. Ariel Miller
Las Vegas, NV USA - Wednesday, February 04, 2004 at 20:47:27 (EST)
Mr. Stein I got 68,856 on the Shellgame can you please test me tommarrow?!!!!!
PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLllEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAASSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSEEEEEEEEEEEEEEEEEEEEEEE
Adam G. 8 Class: 3-302
Forest Hills, N.Y USA - Wednesday, February 04, 2004 at 17:31:41
(EST)
I like dhfjtywetrtyDFRWER
Bodhi 6 103
USA - Tuesday, February 03, 2004 at 21:39:56 (EST)
hey Mr. Stein i like your new toy its really cool and my cousin linda
is here she says hi and she is wishing to move here because her old school
stinks on ice. She wants to come to your computer class becuase i told
her you were fun and she has no recess,computer,and/or gym. so see you
on friday! bye!!!!!!!!
Laureta L. 503,10
New York, ny USA - Tuesday, February 03, 2004 at 20:24:17 (EST)
i was on the website
emma 5 k-013
USA - Tuesday, February 03, 2004 at 10:03:19 (EST)
Dear Daddy I Love you so mush.I miss you.
Nathalia 6 103
USA - Tuesday, February 03, 2004 at 09:35:53 (EST)
Hi Ms. Sawicki! From Lake Worth to New York, we miss you! Come visit
soon!!
Eric Clark
Lake Worth, FL USA - Monday, February 02, 2004 at 19:57:04 (EST)
love the crystal ball and all the cool activies.
Marie10z
st.albans, ny USA - Monday, February 02, 2004 at 13:55:20 (EST)
Hi, I live in Jackson, NJ However; I am emailing you from Las Vegas,
Nevada where I recently spent a week on vacation sightseeing. I visited
Valley of Fire,Red Rock Canyon, Mount Charleston, and many additional sights
and shows. I would especially like to say hello to my Niece Miss Melissa
and to say hello to all in kindergarten at PS 101.
Michael Sawicki ,57, Associate
Jackson, NJ USA - Monday, February 02, 2004 at 02:48:21 (EST)
Hello, Miss Sawicki (it's your favorite cousin Linda HAHA!!) and a
BIG Hello to the Kindergarden class of PS101, Keep up the good work!!!
Linda, 28
Jackson, NJ USA - Sunday, February 01, 2004 at 20:48:41 (EST)
Hello Ms. Sawicki's class! I am a friend of Ms. Sawicki's from Florida.
I am so glad to be able to help you with your project! I hope you are all
learning a lot! Sommar Clark
Mrs. Sommar Clark
Lake Worth, FL USA - Sunday, February 01, 2004 at 19:41:15 (EST)
Hi, am Harun. I love your potato head.
Harun Kadribegic, 6, 101
forest hills, NY USA - Sunday, February 01, 2004 at 14:27:53 (EST)
I like the movie.Love Taylor
Taylor 5 k011
USA - Sunday, February 01, 2004 at 12:02:16 (EST)
WHAT DO WE WIN FOR THE SHELL GAME CONTEST???
JONETTE
USA - Sunday, February 01, 2004 at 11:01:53 (EST)
I HAVE A NEW HIGH SCORE!!!!! 76875!!!!!!!!!!!! I HAVE ALL PROFF 4 U
ON MONDAY!!!!I WILL WIN!!!!
JONETTE
NORWALK, CT USA - Sunday, February 01, 2004 at 10:59:19 (EST)
MR STEIN!!! I HAVE 65665 in the SHELL GAME!!!! THIS IS MY NEWEST HIGH
SCORE!!!!! i have it 4 u in monday!
JONETTE
Norwalk, CT USA - Sunday, February 01, 2004 at 10:54:37 (EST)
hi
nadine
USA - Saturday, January 31, 2004 at 22:34:53 (EST)
tuetrtyi i
bhhsrt
gjd tdy, dtyutdu USA - Saturday, January 31, 2004 at 19:38:42 (EST)
MR STEIN I ALOS CAN PROVE TO YOU THAT I HAD THID SCORE!! I HIT PRINT
SCREEN AND I WILL PRINT IT OUT AT HOME I"LL SHOW YOU ON MONDAY AFTERSCHOOL!!!
It's Jonette AGAIN
USA - Saturday, January 31, 2004 at 19:08:00 (EST)
MR STEIN!!!!! I played the shell game and my highest score is 43370!!!!!!!!
I hope I win!
Jonette 11 601
Norwalk, Ny USA - Saturday, January 31, 2004 at 19:04:40 (EST)
Mr. stien please find out man missing please!!!!
Igor 7 2-204
USA - Saturday, January 31, 2004 at 13:20:04 (EST)
I downloaded the weird movie.
Susan / 9 /402
Forest Hills, NY USA - Saturday, January 31, 2004 at 07:53:44 (EST)
to my daughter anna maria 7 (202) i miss you lots princess and its
cold here,and want a hug,say hi to your friends and teachers,lots of love
Daddy xx
dale 32 parent
london, UK - Saturday, January 31, 2004 at 01:48:12 (EST)
Hi I'm Natalie Paret and i just wanted to say that I'm enjoying my
3rd year at P.S.101. I hope that I will keep having fun later on and I
hope my entry has helped the guestbook!
Natalie Paret ,11, Class 603
N.Y.C, N.Y USA - Friday, January 30, 2004 at 22:16:25 (EST)
Hey Mr. Stein, I finally beat my score on tthe shell game contest.
So I'll bring in the better score instead. Oh, and my score is 93,690!
And can I have three chances at my computer class.
Nick B. Age 9 Class 401
Forest Hills, NY USA - Friday, January 30, 2004 at 17:52:54 (EST)
I GOT 7207O ON PROGRESSIVE LEVEL SHUFFLE LEVEL 10.
Adam Silverstein age 9 class 401
New York city, NY USA - Friday, January 30, 2004 at 15:47:42 (EST)
Hey Mr. Stein! Please put the movie on the website!
Jennifer H. 9 Class 401
F.H., N.Y. USA - Thursday, January 29, 2004 at 23:35:25 (EST)
Next year my afterschool is going to be General Sports and Playtime
party.
Daniel Z. 6 102
USA - Thursday, January 29, 2004 at 20:24:22 (EST)
My afterschool is Juniur Chess and Alley Pond.
Daniel Z. 6 102
USA - Thursday, January 29, 2004 at 20:17:22 (EST)
Hey its me im in 7th grade in Russell Sage I miss P.S. 101 so much!!!!!!!
P.S.101 Rocks!!!
Jenifer W.
Kew Gardens, NY USA - Thursday, January 29, 2004 at 19:26:57 (EST)
I think you are a great teacher.
Cassandra 201
USA - Thursday, January 29, 2004 at 17:56:26 (EST)
why is the calendar not working, mr. stein???
shirley l.
forest hills, ny USA - Thursday, January 29, 2004 at 17:09:34 (EST)
why is the calendar not working, mr. stein???
shirley lu=.
forest hills, ny USA - Thursday, January 29, 2004 at 17:09:22 (EST)
Your work is perfict.
Daniel Z. 6 102
USA - Thursday, January 29, 2004 at 16:30:51 (EST)
please put the 3 games on my website and Ill be perfict in the classroom.
Daniel Z. 6 102
USA - Thursday, January 29, 2004 at 16:27:41 (EST)
Hello Everyone
Mr. G Class 204
USA - Thursday, January 29, 2004 at 14:25:18 (EST)
I really really like the crazy movie and the spiral. I think you should
put new things on the website
Granit
NY USA - Thursday, January 29, 2004 at 09:43:54 (EST)
I really really like the crazy movie and the spiral. I think you should
put new things on the website
Granit
NY USA - Thursday, January 29, 2004 at 09:43:45 (EST)
I like the snowglobe.
Anna 7 202
USA - Thursday, January 29, 2004 at 08:58:57 (EST)
Hello there, I'm in St. Petersburg, Russia now. There is about -3C
degree outside and falling snow. The roads are very slippery and maddy.
Not a good place to be in now. Buy, Dave.
David Lubinitsky, father of Joel and Daniel Lubinitsky
USA - Thursday, January 29, 2004 at 07:40:15 (EST)
One day, there was a person. His name was I Hate You. "I hate you!!"
his best friend called. "I hate you, too," I hate you cried. Then Henry
Stinky grabbed him and
Debbie Darlinalahulooesev, 6, I'm not sure
North America, US United States of America - Wednesday, January
28, 2004 at 16:37:49 (EST)
i no where u got the illusions. i hav the book at home with me. the
great book of optical illusions by gyles brandreth.
Illusion 602
forest hills, NY USA - Wednesday, January 28, 2004 at 12:46:37 (EST)
Hey Mr. Stein I beat the shell game with 92880 points. Beat that people!
Also I want THREE CHANCES to play Shell Game in my computer class. See
you later.
Nick B. Age 9 Class 401
Forest Hills, NY USA - Tuesday, January 27, 2004 at 22:07:49 (EST)
What is the weird movie?
Max L.,9,601
Forest Hills, NY USA - Tuesday, January 27, 2004 at 21:18:30 (EST)
Thank you for putint on the coloring.
dina 8 203
Queens, N.Y. USA - Tuesday, January 27, 2004 at 19:28:48 (EST)
Thank you for putint on the coloring.
dina 8 203
Queens, N.Y. USA - Tuesday, January 27, 2004 at 19:26:53 (EST)
hi Mr. Stein I just wanted to win the gyroscope.have a good newyear.bye.
justin wong class 204
ny USA - Tuesday, January 27, 2004 at 15:54:48 (EST)
I MEANT 28z!!!! I should have known better, especially for someone
who knows that a file goes in a folder.
28z
Forest Hills, NY USA - Tuesday, January 27, 2004 at 10:16:03 (EST)
I enjoyed browsing your website. The links are both educational and
fun. I plan on sharing the site with my students.
z28
Forest Hills, NY USA - Tuesday, January 27, 2004 at 10:14:30 (EST)
As I viewed the illusion section, my children at home were trying to
figured them out. We all enjoyed this site.
Elizabeth22z,edse603
New York, NY USA - Monday, January 26, 2004 at 23:51:26 (EST)
As I viewed the illusion section, my children at home were trying to
figured them out. We all enjoyed this site.
Elizabeth22z
New York, NY USA - Monday, January 26, 2004 at 23:42:38 (EST)
Professor Stein this site is so interesting, I am trying to get internet
access in my class so my students can enjoy the many fun and exciting benefits
of this site!!!
Jennifer Joly , EDSE 603
Bronx, NY USA - Monday, January 26, 2004 at 20:00:40 (EST)
I think you should keep the movie because I will do my homework and
it's cool.
Josh 9 401
N.Y. USA - Monday, January 26, 2004 at 19:16:38 (EST)
I know the secert for the card trick!!!!!!!!!!!!!!!!!
James C. 9 303
New York City, NY USA - Monday, January 26, 2004 at 11:01:47 (EST)
I liked the movie can you please put it on again?
nandini5k-011
NYC, NY USA - Sunday, January 25, 2004 at 19:55:30 (EST)
plescenupotonthemoovemisturstin
nandini5k-011
USA - Sunday, January 25, 2004 at 19:50:24 (EST)
I like the movie.Love Taylor
Taylor 6 K-011
USA - Sunday, January 25, 2004 at 17:22:13 (EST)
Hey Mr. Stein how r u? im going on your website every day.You should
download more songs on the computers so we have more fun.
Laureta,10,503
New York, ny USA - Sunday, January 25, 2004 at 17:08:07 (EST)
If you put the movie on my website I'll be perfect in the class.
Daniel Z. 6 102
USA - Sunday, January 25, 2004 at 15:01:22 (EST)
I
JAELYN, P.S.97
WOODHAVEN, NY USA - Sunday, January 25, 2004 at 11:14:37 (EST)
I
Jaelyn
woodhaven, ny USA - Sunday, January 25, 2004 at 11:13:17 (EST)
Hello, Mr.Stein. I am really dizzy from watching your movie.
Susan 9 402
Forest Hills, NY USA - Saturday, January 24, 2004 at 19:42:16 (EST)
I like the crazy movie please put it on your web site
sabrina 7 201
USA - Saturday, January 24, 2004 at 11:29:18 (EST)
Hey Mr. Stien!! I'm in Norwalk Connecticut 4 da weekend!! see ya in
afterschool on monday!
Jonette 11 601
Norwalk, Ct USA - Saturday, January 24, 2004 at 10:08:12 (EST)
dear mr. stein; i like the music video.
lucy ko11
USA - Friday, January 23, 2004 at 18:14:36 (EST)
piescanupotonthemoove
nandini5k-011
USA - Friday, January 23, 2004 at 15:16:59 (EST)
I don't get your missing man
Manar and Tylah 9 402
Forset Hills, NY USA - Friday, January 23, 2004 at 10:20:13 (EST)
youarethebest teacherever
joanne10402
Foresthills, NNY USA - Friday, January 23, 2004 at 10:19:58 (EST)
I will get left back in 6th grade just to see that movie. I will also
die for it. plllllllllllllllllllllllllllllleeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeesssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssseeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Adam G. 8 3-302
Forest Hills, N.Y. USA - Thursday, January 22, 2004 at 22:44:36
(EST)
Please put the movie on my website
Borja 6 102
jan.22,2004 USA - Thursday, January 22, 2004 at 20:40:16 (EST)
DearMr.Stein, Please put the movie on my website and I'll be very good
in the classroom.
Daniel Z. 6 102
USA - Thursday, January 22, 2004 at 19:28:27 (EST)
DEAR MR.STEIN, I really want you to put the movie in the downloads
section,so please
VICTOR,8,3-302
N.Y, N.Y USA - Thursday, January 22, 2004 at 17:14:25 (EST)
To whomever it may concern: PLEASE NOTE THAT LAST NAMES, EMAIL ADDRESSES
AND OTHER PERSONAL INFORMATION IS NOT PERMITTED ON THIS GUESTBOOK. THIS
IS DONE FOR SAFETY PURPOSES. It has come to my attention that several kids
are complaining that they liked last year better than this year. The reasons
shall be left "Unknown" for precautionary matters. I am making a poll to
see how many children liked this year better and how many children liked
last year better. Also, I am making another poll seeing whether students
are learning more this year or last year. Please submit answers/opinions
to DELETED or you can IM me on AIM. My SN is DELETED. P.S.- This survey
will not be used for school projects and/or reports.
Bryan C., 11, 603
Forest Hills, NY USA - Thursday, January 22, 2004 at 17:02:15 (EST)
Mr.Stein you are so funny and I will never change.
Alana 7 201
USA - Thursday, January 22, 2004 at 09:50:31 (EST)
I did the usa map.
sabrina 7 201
USA - Thursday, January 22, 2004 at 09:48:33 (EST)
megan and i really want the crazy movie on the website.
chloe and megan 7 class201
USA - Thursday, January 22, 2004 at 09:45:44 (EST)
please put the crazy movie on your web site
sabrina 7 201
USA - Thursday, January 22, 2004 at 09:45:35 (EST)
i did the usamap and i finished it first. and i beg you to put the
crazy movie on the website.
chloe 7 class201
USA - Thursday, January 22, 2004 at 09:41:24 (EST)
Daer MR.STEIN, I'm begging for the "WEIRDMOVIE"because it is cool and
it added a long part to my imaganation,so please add it to the website.
Victor,8,3-302
N.Y, N.Y USA - Wednesday, January 21, 2004 at 22:34:02 (EST)
please put the movie on the website, I will respect you and be better
behaved.
donovan levy 8 302
USA - Wednesday, January 21, 2004 at 20:46:27 (EST)
Mr. Stein, plaseeeeeeeeee put wired movie on downloading section, Thank
you very much. Your friend David Glinski
David.Glinski,8,302
forest hills, ny USA - Wednesday, January 21, 2004 at 17:17:02 (EST)
i like evrything on your computer.
ryan 5 k012
USA - Wednesday, January 21, 2004 at 16:46:02 (EST)
Hello every one in the school. I Know how to say SUPERFRAGICARALISTICEXPEALIDOSIOS!
Or, Something like that. :-) Happy :-D Elated :-X My lips are sealed =^..^=
MEOW! ^-^ YAY! d:-) Happy cap wearing person d:-( Opposite of happy cap
wearing person 0k Running Stick figure Those Were the stick figures O'
the day!!!!
Taylor C.
Forest Hills, NY USA - Wednesday, January 21, 2004 at 10:35:25 (EST)
MEEEEEESTER LUUUUUUUUUUUUUUKE IIIIIIIIIIIIIIIIS SOOOOOOOOOOOOOOOOOOOOOOO
ANCIEEEEEEEEEEEEEEEENT! YAAAAAAAAAAAAAAAAAAAAAAAAAAH!
Shunella L., 10, 502
Forest Hills, NY USA - Wednesday, January 21, 2004 at 10:32:59 (EST)
i lik the movy.
areta 5 k-0121
USA - Wednesday, January 21, 2004 at 09:43:45 (EST)
rowena and rachel is a bast friend.we likme togo houme see mommy and
daddy.
rowena 5 rachel 5 k011
USA - Wednesday, January 21, 2004 at 09:40:11 (EST)
nandini and winifred are friends. we want the movie on the website.
nandini5winifred5k-011
USA - Wednesday, January 21, 2004 at 09:37:54 (EST)
You are nice.Love Tsylor
Taylor 5 k-011
USA - Wednesday, January 21, 2004 at 09:36:57 (EST)
You are nice.Love Tsylor
Taylor 5 k-011
USA - Wednesday, January 21, 2004 at 09:36:54 (EST)
I like the move.Love Taylor
Taylor 5 k-011
USA - Wednesday, January 21, 2004 at 09:33:00 (EST)
I like the move.Love Taylor
Taylor 5 k-011
USA - Wednesday, January 21, 2004 at 09:32:59 (EST)
I like the move.Love Taylor
Taylor 5 k-011
USA - Wednesday, January 21, 2004 at 09:32:56 (EST)
conner and remy are best friends. we like the movie.
remy 5 conner 5 k-011
USA - Wednesday, January 21, 2004 at 09:17:42 (EST)
i like the move
ryan 5 k012
USA - Tuesday, January 20, 2004 at 19:29:11 (EST)
dear mr.stein can you plese show me how to get to the movie
isabella 5 k-012
ny, new yourk USA - Tuesday, January 20, 2004 at 17:58:05 (EST)
Mr. Stein, I enjoyed the jigsaw puzzle, I was able to put you together.
I also enjoyed hangman and the crossword puzzles. See you tuesday night.
Heather Adler , Mr. Stein student at Touro 03z
USA - Tuesday, January 20, 2004 at 14:52:04 (EST)
I am a mystery person. 3 clues: 1. I am a boy 2. I am not a girl 3.
I go to the boy's bathroom
???
???, ?? USA - Tuesday, January 20, 2004 at 13:50:08 (EST)
Hahahhahaaahhahahahahahahaha I know a joke which is SOOOOOOOOOOO funny.
Henry, 12, 601
NYC, NY USA - Tuesday, January 20, 2004 at 13:46:30 (EST)
It is a good website. I like the Learning Activities Section "It's
fun to read". It includes art gallery, magic, tounge twisters, and riddle
materials. In my opinion, it's interesting and engaging for kids, and it
has a fun approach, because kids read and do things using a computer.
Afina Aslanidi, EDSE 603, 05z
USA - Tuesday, January 20, 2004 at 12:55:19 (EST)
I L0VE THE ALIENH HAV A GRAT DAY
ISABELLE 5 K-012
USA - Tuesday, January 20, 2004 at 11:12:03 (EST)
i like the movie
andy 5 sbastian 5 k-012
USA - Tuesday, January 20, 2004 at 10:49:46 (EST)
This is a great website.I showed it to my fiance's daughter and she
loves it. I can't wait to use it when I start teaching..
Daniela, 24, EDSE 603 02z
USA - Tuesday, January 20, 2004 at 10:29:05 (EST)
iwant the eggs byadelquiclairbel.
adelqui claribel
truglia rivera, USA - Tuesday, January 20, 2004 at 09:50:32 (EST)
Your website is great! I can't wait to start teaching so that I can
use some of the great stuff you have to offer to your students.
Tara, 22, edse603, 23z
WOODBURY, NY USA - Monday, January 19, 2004 at 23:56:30 (EST)
I like your games
Paola ,11 602
Queens, N.y. USA - Monday, January 19, 2004 at 20:21:47 (EST)
I want you to put the crazy movies on the web.
Emily6101 6:04
USA - Monday, January 19, 2004 at 18:06:18 (EST)
I like the movie
isabella 5 k-012
ny, new yourk USA - Monday, January 19, 2004 at 15:31:46 (EST)
dear mr.stain Thank you for teaching me about computers. Love eugene.
eugene , 6 ,102
forest hills, ny USA - Monday, January 19, 2004 at 12:41:46 (EST)
My brother and I put together you're puzzle. He wanted to do it. We
have to study or sleep now.
3318
USA - Sunday, January 18, 2004 at 21:53:42 (EST)
This is cool
alex
edgewater, N.J. USA - Sunday, January 18, 2004 at 21:39:43 (EST)
It is Adina again,i forgot to write my prefix number.
Adina Novick 21z, age 22, class EDSE 603 MA
New York, NY USA - Sunday, January 18, 2004 at 19:15:31 (EST)
It is Adina again,i forgot to write my prefix number.
Adina Novick 21z, age 22, class EDSE 603 MA
New York, NY USA - Sunday, January 18, 2004 at 19:14:09 (EST)
It is Adina again,i forgot to write my prefix number.
Adina Novick 21z, age 22, class EDSE 603 MA
New York, NY USA - Sunday, January 18, 2004 at 19:12:01 (EST)
Professor Stein, I am looking forward to taking this class with you.
This web site that you have created is very interesting and is a good idea
for people to meet and communicate from far away places.
Adina Novick, age 22, class EDSE 603 MA
New York, NY USA - Sunday, January 18, 2004 at 19:07:42 (EST)
Great website. I have already used it for ELA prep in my classroom!!!
18z
Forest Hills, NY USA - Sunday, January 18, 2004 at 14:16:37 (EST)
mister stien i like your website
omri7
america, u.s.a. USA - Sunday, January 18, 2004 at 14:11:01 (EST)
YOUR OPTICAL ILLUSIONS ARE REALLY VERY ORIGINAL AND CAPTIVATING
Isabel-25z
Brooklyn, N.Y. USA - Sunday, January 18, 2004 at 13:55:18 (EST)
please put the movie on
borja 6 102
USA - Sunday, January 18, 2004 at 13:08:33 (EST)
hi mr.stien this is shenequewa from mr.parlini's class
shenequewa 603
USA - Sunday, January 18, 2004 at 11:38:46 (EST)
Hello from Julie- 12Z Dear Professor Stein: Wow, everything on website
is fantastic. I made 2 movies last year with movie player, and I had added
some animation to the movie. You have now provided me with some great information
and ideas for my next family movie. Gosh, I wish I had taken this course
before. My movies would have been ten times better. Oh, well, now I will
get a chance to see what it is like to create a website. I can't wait.
Thanks :) Professor Stein Sincerely, J. Hannibal
Juliette, young at heart ,EDSE 603 MA
MT. VERNON, NY USA - Sunday, January 18, 2004 at 11:11:09 (EST)
please put on the movie on my website
Daniel Z. 6 102
USA - Sunday, January 18, 2004 at 10:22:26 (EST)
mr stein, its very rainy today so im playing on the computer. have
a great day
isabelle, 5, k012
nyc, USA - Sunday, January 18, 2004 at 10:16:09 (EST)
I really like it!!! I enjoyed to play it. Thanks.
Sp. Ed.603 Nelli Ciccarello
Cliffside Park,, NJ USA - Saturday, January 17, 2004 at 15:28:54
(EST)
Dear Mr.Stein I liked the second movie. It made my brain hurt. And
I liked it.
Claire 6 102
USA - Saturday, January 17, 2004 at 11:18:11 (EST)
I like the movie so, so, so, so, SO much. It is DNA riffic! Can you
put on your website? Please?! Please?! PLEASE?!
Will 6 101
Forest Hills, NY USA - Saturday, January 17, 2004 at 10:59:46 (EST)
Prof. stein I installed netscape onto my computer, however when I tried
to go to your website using netscape the computer said it could not locate
a netscape server.
19zelisha michel
USA - Saturday, January 17, 2004 at 10:11:51 (EST)
Professor Stein, I think this is a great website. It is useful for
students, teachers, and parents. I found three sites that I would like
to show my first grade class; make a composite animal, reading fun activities,
and the number pairs that equal ten. I think these will be fun and exciting
for them to learn.
Erica, 06z, EDSE603
New York, NY USA - Friday, January 16, 2004 at 22:27:05 (EST)
I think you guys are doing a great job. Keep it up!
Lennard Charles
USA - Friday, January 16, 2004 at 21:56:59 (EST)
I like the blinking eye. You're website is so cool.It's the best. Have
you made somethin new latley.
Jessica B. 8 302
USA - Friday, January 16, 2004 at 16:55:34 (EST)
Dear Mr.Stein, Could you put crazy movie 1 and 2 on your website so
my family can see it? Thanks alot!
Harrison 6 101
USA - Friday, January 16, 2004 at 15:36:47 (EST)
i did the test prep.
Amandine
Queens, NY USA - Friday, January 16, 2004 at 10:34:25 (EST)
I finished the ELA practice and got them all right.I also like the
ollusions.
Tylah 9 402
New York, N.Y USA - Friday, January 16, 2004 at 10:24:25 (EST)
the like the
michael5 k013
USA - Friday, January 16, 2004 at 09:39:51 (EST)
the like the
michael5 k013
USA - Friday, January 16, 2004 at 09:39:50 (EST)
the like the
michael5 k013
USA - Friday, January 16, 2004 at 09:39:49 (EST)
the meve osam
krishen 6 k013
USA - Friday, January 16, 2004 at 09:37:53 (EST)
i like the movie
tristan s. 5 k013
USA - Friday, January 16, 2004 at 09:22:29 (EST)
I really like the bird that can be flipped.
Ian 6 101
USA - Friday, January 16, 2004 at 09:04:54 (EST)
dear mr stein i like the movie
daisey 6 101
USA - Friday, January 16, 2004 at 09:04:46 (EST)
I really like the bird that can be flipped.
Harrison 6 101
USA - Friday, January 16, 2004 at 09:02:35 (EST)
I want the movie on the website because it is crazy and funny.
Gaby 6 101
USA - Friday, January 16, 2004 at 08:42:50 (EST)
edse60319z. Prof. stein your web page is cool. I would like to make
one similar to it.
19z Elisha Michel
USA - Thursday, January 15, 2004 at 21:58:52 (EST)
I want to get a T.V..
reona, 6, k-014
USA - Thursday, January 15, 2004 at 20:26:53 (EST)
ilrtv
reona6
USA - Thursday, January 15, 2004 at 20:21:27 (EST)
Dear Mr.Stein Please, pretty,pretty please put the movie on the website.
Abigail 6 102
Forest Hills, ny USA - Thursday, January 15, 2004 at 19:57:07 (EST)
Hi professor Stein, I'm trying to complete my homework assignment before
my Thursday class begins. This website is full of surprises and I am hoping
to enjoy it. Hope you had a good day.
Elizabeth22z,edse603
New York, NY. USA - Thursday, January 15, 2004 at 17:01:21 (EST)
Hi professor, I had to write again because I forgot to state my file
name on the previous one. Well I think your website is very informative
not just for the children but for the adults as well. I will enjoy myself
viewing it and playing as well.
Elizabeth,22z,edse603
New York, NY. USA - Thursday, January 15, 2004 at 16:57:01 (EST)
Hi Professor had to write you again because I forgot some important
information required by you. Once again I hope you had a nice day.
Elizabeth,22z,edse603
New York, NY. USA - Thursday, January 15, 2004 at 16:51:27 (EST)
Hi professor Stein, I'm trying to complete my homework assignment before
my Thursday class begins. Hope you had a good day.
Elizabeth O
New York, NY. USA - Thursday, January 15, 2004 at 16:47:18 (EST)
This website has a lot of useful information for students, teachers,
and parents. I like the way that it lets children be creative while learning,
for example through the reading fun link.
Debra, 09z, EdSE 603 MA
New York, NY USA - Thursday, January 15, 2004 at 16:42:43 (EST)
hey Mr.Stein its Granit i liked that crazy movie and i just want to
say thank you for showing the movie.
Granit 7 class 201
New York, ny USA - Thursday, January 15, 2004 at 14:59:22 (EST)
I think the movie makes you a star.
Ryan 7 204
USA - Thursday, January 15, 2004 at 14:28:54 (EST)
Mr.Stein,the weirdmovie and the bird thng is tottaly aswome,dude!
Alicia 7 204
USA - Thursday, January 15, 2004 at 14:28:04 (EST)
The weirdmovie was totally awsome
Colleen 7 204
USA - Thursday, January 15, 2004 at 14:26:29 (EST)
I loved the first movie. It was awsooooooooooooooooooome and cooooooooooooooooooool
I felt like I was inside my mind.
Eliseo Labayen 8 401
New York, Ny USA - Thursday, January 15, 2004 at 13:49:20 (EST)
VERY VERY FUNNY BIRDFISH ILLUSION. VERY VERY FUNNY.
Amy 9 401
NY, NY USA - Thursday, January 15, 2004 at 13:48:52 (EST)
My favorite optical illsoin is lady or scottman can you see both?
Aneisha 9 401
USA - Thursday, January 15, 2004 at 13:48:33 (EST)
WEIRDMOVIEONCOMPUTERWASALITTLECOOL.
Amy 9 401
NYC, NY USA - Thursday, January 15, 2004 at 13:46:35 (EST)
Please put the movie on. It was cccccccooooooooooooooollllllllllll
Ivan S age 9 401
USA - Thursday, January 15, 2004 at 13:45:22 (EST)
THE OPTICAL ILLUSIONS ARE A "WOW," MR. STEIN!!!
Amy 9 401
NYC, NY USA - Thursday, January 15, 2004 at 13:44:15 (EST)
The movie was so cooooooooolllll! Ireally liked it
Ivan age 9 401
USA - Thursday, January 15, 2004 at 13:43:12 (EST)
I love the movie!It feels like your in it!Also the illusions are fun.
Margaret9401
NYC, NY USA - Thursday, January 15, 2004 at 13:40:30 (EST)
I like the steps up
Ivan S age 9 401
USA - Thursday, January 15, 2004 at 13:40:26 (EST)
DEAR mr.Stien, I want you to puton the movie on my website
Daniel Z. 6 102
USA - Thursday, January 15, 2004 at 13:06:42 (EST)
please put the movi on
borja 6 102
USA - Thursday, January 15, 2004 at 13:06:41 (EST)
DEAR,MR.STIEN
ABIGAIL 6 102
USA - Thursday, January 15, 2004 at 13:06:28 (EST)
I liked the movie and it makes me dizzy.
Charlotte 6 102
USA - Thursday, January 15, 2004 at 13:06:00 (EST)
you are my best buddy.
louis 6 102
USA - Thursday, January 15, 2004 at 13:04:13 (EST)
Dear Mr. Stien Can pretty pretty please put the movies on our computers.
Love, Justin
Justin 6 102
USA - Thursday, January 15, 2004 at 13:02:34 (EST)
I now how to do your websight I now your websight mr stin.
Jaelah 7 102
USA - Thursday, January 15, 2004 at 13:02:06 (EST)
Hi this is Daniel Z. would you please put the movie on my website.
Daniel Z. 6 102
USA - Thursday, January 15, 2004 at 13:01:13 (EST)
pleas put the moive on
danielt. 6 102
USA - Thursday, January 15, 2004 at 12:59:32 (EST)
thankyou for showing us the movie.
derek 6 102
USA - Thursday, January 15, 2004 at 12:59:06 (EST)
i like to jump
sarah 7 102
USA - Thursday, January 15, 2004 at 12:58:48 (EST)
Dear Mr. Stein Please put the movie on your website.
Sophia 7 102
USA - Thursday, January 15, 2004 at 12:32:56 (EST)
sorry i forgot to about that, i forgot to put my correct information
down.
Dena27z edse 603 ma
USA - Thursday, January 15, 2004 at 11:13:35 (EST)
Dear Professor Stein, I have truely enjoyed visiting this site. It
was fun and insightful. I could only imagine what the children think. I
enjoyed most of all the number pairs that equal ten (that is what we are
currently doing in my first grade class).
Dena, 22
USA - Thursday, January 15, 2004 at 11:09:41 (EST)
ilamobo14
reona6
USA - Thursday, January 15, 2004 at 10:26:26 (EST)
i like move
rachel 5 k014
USA - Thursday, January 15, 2004 at 10:20:54 (EST)
ilamob
reona6
USA - Thursday, January 15, 2004 at 10:20:10 (EST)
ilike mymoviye
iasm sylvie 5ko14v
USA - Thursday, January 15, 2004 at 10:20:08 (EST)
i like movie
reona 6 k014
USA - Thursday, January 15, 2004 at 10:09:30 (EST)
I like the crazy iovie please put it on the
chris 7 ps101
USA - Thursday, January 15, 2004 at 09:50:42 (EST)
dear,mr.stein i wrote this message to tell you hi
lauren,7,201
USA - Thursday, January 15, 2004 at 09:42:41 (EST)
i like the
jaclyn 7 201i
USA - Thursday, January 15, 2004 at 09:41:19 (EST)
I like the crazy movie please put it on the website.
Matthew Class 201 7
USA - Thursday, January 15, 2004 at 09:40:15 (EST)
I like the crazy movie please put it on the website.
Matthew Class 201 7
USA - Thursday, January 15, 2004 at 09:40:14 (EST)
I like the crazy movie please put it on the website.
Matthew Class 201 7
USA - Thursday, January 15, 2004 at 09:40:13 (EST)
I like the crazy movie please put it on the website.
Matthew Class 201 7
USA - Thursday, January 15, 2004 at 09:39:54 (EST)
i like the card
valentina 8 2-201
USA - Thursday, January 15, 2004 at 09:38:08 (EST)
dear, mr. stein i wrote this message so you can put the viode on the
screen for us.
lauren,7,201
USA - Thursday, January 15, 2004 at 09:36:50 (EST)
I like the movie thing.
Cassandra 7 201
USA - Thursday, January 15, 2004 at 09:35:12 (EST)
Ilike the crazy move
ester7201
USA - Thursday, January 15, 2004 at 09:35:06 (EST)
Put the crazy movie on.
Daniel 8 201
USA - Thursday, January 15, 2004 at 09:33:52 (EST)
I want the crazy movie in our website
Granit 7 class201
USA - Thursday, January 15, 2004 at 09:33:13 (EST)
I like a crazy movie I will leave a message
Amane 7 201
USA - Thursday, January 15, 2004 at 09:33:04 (EST)
Should I put that crazy movie on our website? I will if I receive alot
of messages
Mr. Stein 26 201
USA - Thursday, January 15, 2004 at 09:18:19 (EST)
please put the movie on the website.
Conner 5 k-011
USA - Wednesday, January 14, 2004 at 09:27:14 (EST)
It is a good website. Very easy to navigate. It has many things that
elementary schoolers and middle schoolers will find fascinating and fun.
Darrell26z from EdSe 603 MA
Bronx, NY USA - Wednesday, January 14, 2004 at 08:34:10 (EST)
Your the best and your website is really cool.
Krishangi Geet Krishna 6
USA - Tuesday, January 13, 2004 at 20:20:08 (EST)
Your the best and your website is really cool.
Krishangi Geet Krishna 6
USA - Tuesday, January 13, 2004 at 20:20:07 (EST)
You are the best and your website is really cool website I every seen
K rishangi Geet Krishna 6
USA - Tuesday, January 13, 2004 at 20:13:43 (EST)
You are the best and your website is really cool website I every seen
K rishangi Geet Krishna 6
USA - Tuesday, January 13, 2004 at 20:13:43 (EST)
Test Message
Dan Stein EDS# 603 01z
USA - Tuesday, January 13, 2004 at 20:03:49 (EST)
You are the best your website is relly cool I like it a lot .
Krishangi Geet Krisna 6
USA - Tuesday, January 13, 2004 at 20:02:58 (EST)
You are the best your website is relly cool I like it a lot .
Krishangi Geet Krisna 6
USA - Tuesday, January 13, 2004 at 20:02:56 (EST)
I like the movie
isabella 5 k-012
ny, new yourk USA - Tuesday, January 13, 2004 at 18:24:17 (EST)
I like the movie
isabella 5 k-012
ny, new yourk USA - Tuesday, January 13, 2004 at 18:17:41 (EST)
I finished the puzzle.
Jonathan Lewis, 5,
Forest Hills, NY USA - Tuesday, January 13, 2004 at 17:51:19 (EST)
i love you love isabelle.
isabelle 5 k-o12
USA - Tuesday, January 13, 2004 at 11:09:28 (EST)
i love you love Evalena.
evalena 5 k-o12
USA - Tuesday, January 13, 2004 at 11:09:20 (EST)
hello
anthony 5 k012
USA - Tuesday, January 13, 2004 at 11:01:14 (EST)
i like the movie,.
christine 5 k-012
USA - Tuesday, January 13, 2004 at 10:49:16 (EST)
I like the Illusion with the canoe and the fish
Patricio 11
Forest Hills, NY USA - Monday, January 12, 2004 at 14:38:03 (EST)
Ilove this school!
Jennifer,12,602
Forest Hills, NY USA - Monday, January 12, 2004 at 14:29:14 (EST)
Hey... i know where to find more optical illusion. You should go to
www.funkypages.com
Jabir
Somewhere in there, USA - Monday, January 12, 2004 at 14:22:43 (EST)
I like the Bird and the cup.
Bernice,7,203
NY, USA - Monday, January 12, 2004 at 13:03:47 (EST)
I liked the optikal illusiun that looked like a rabbit and a duck
Alison,7,class 203
Forest Hills, NY USA - Monday, January 12, 2004 at 13:00:00 (EST)
i liked six or seven cubes
Armando,203,7
N.Y., F.H USA - Monday, January 12, 2004 at 12:58:23 (EST)
i like the one when it spelled the word lift. It was hard to see!
Elise class 203
USA - Monday, January 12, 2004 at 12:54:22 (EST)
I like are there 6 or 7 cubes?
Jessica 7 203
N.Y.C., NY USA - Monday, January 12, 2004 at 12:49:48 (EST)
i like the dot one
8 hassan
USA - Monday, January 12, 2004 at 12:44:29 (EST)
I saw the opticla illusinos with my family and it was so cool
Lauren Isra
forest hills, ny USA - Sunday, January 11, 2004 at 18:54:13 (EST)
the opticla illusinos with my family and it was so cool
Lauren Isra
forest hills, ny USA - Sunday, January 11, 2004 at 18:53:33 (EST)
i looked at all the optical illusions with my brother Granit.They were
so cool.See you on Friday!
Laureta L.
New York, ny USA - Saturday, January 10, 2004 at 10:52:35 (EST)
Please enter me in the Magic Rock Contest
Jean L.,8,303
Forest Hills, NY USA - Friday, January 09, 2004 at 23:02:42 (EST)
I am with my friend, joe
jordan 8 301
USA - Friday, January 09, 2004 at 21:04:05 (EST)
I like zak the rat and rap music
Bodhi
6 USA - Friday, January 09, 2004 at 20:59:11 (EST)
I like zak the rat and rap musik
Bodhi
6 USA - Friday, January 09, 2004 at 20:58:33 (EST)
I like zak the rat
Bodhi
6 USA - Friday, January 09, 2004 at 20:56:59 (EST)
I was just kidding my sister does like you.
Manar 9 classn 402
Forset Hills, NY USA - Friday, January 09, 2004 at 20:41:03 (EST)
I just got a new CD player it is the color blue with silver. Its the
thing I always wanted. And that is ture about my sister
Manar 9 class 402
Forset Hills, NY USA - Friday, January 09, 2004 at 20:37:18 (EST)
I just got a new CD player it is the color blue with silver. Its the
thing I always wanted. And that is ture about my sister
Manar 9 class 402
Forset Hills, NY USA - Friday, January 09, 2004 at 20:34:32 (EST)
Mr.Stien why did you put playmash on the website now everyones going
to know about it. And just to tell you my little sister says your mean.
Just kidding I just wanted to annoy her.
Manar (9 Class 402)
Forset Hills, NY USA - Friday, January 09, 2004 at 20:32:18 (EST)
Hello to Jabir 602
Mr. Joseph
Jamica , NY USA - Friday, January 09, 2004 at 13:30:24 (EST)
how are you Mr.Stain? you could email me at DELETED BY MR. STEIN- this
is under score
Joshua 8, 302
USA - Thursday, January 08, 2004 at 19:18:52 (EST)
hi mr. stein thank you for showing us all the stuff on the computer
cya on thursday bye
justin7 class 204
ny USA - Thursday, January 08, 2004 at 18:29:22 (EST)
hi mr. stein thank yuo for showing us all the stuff on the computer
cya on thursday bye
justin7 class 204
ny USA - Thursday, January 08, 2004 at 18:29:08 (EST)
Hey Mr.Stein I heard of a bad wedsite. THIS MESSAGE DELETED BY MR.
STEIN. PLEASE DO NOT MENTION BAD WEBSITES.
Manar 9 Class 402
Forset Hills, NY USA - Thursday, January 08, 2004 at 17:55:30 (EST)
i like the games
lala 6 102
USA - Thursday, January 08, 2004 at 12:45:48 (EST)
i like the puzzles.
Yoni 6 102
USA - Thursday, January 08, 2004 at 12:23:01 (EST)
my mom and dad got me the bratz runway disco
sabrina 7 201
USA - Thursday, January 08, 2004 at 09:41:24 (EST)
i like the zoo.
mikhael 7 201
USA - Thursday, January 08, 2004 at 09:38:13 (EST)
My Favorite thing is Switch zoo.
Alana 7 201
USA - Thursday, January 08, 2004 at 09:36:28 (EST)
i like you no who because i think it is cool.
jaclyn7201
USA - Thursday, January 08, 2004 at 09:36:27 (EST)
My favorite thing is switch zoo.
Cassandra 7 201
USA - Thursday, January 08, 2004 at 09:33:49 (EST)
i like swich zoo
florimond 7 201
ny USA - Thursday, January 08, 2004 at 09:33:45 (EST)
i like the card
valentina 8
USA - Thursday, January 08, 2004 at 09:32:15 (EST)
I like the animals best.
Olivia 7 201
USA - Thursday, January 08, 2004 at 09:31:28 (EST)
i liked the christmas card.
chloe 7 201
USA - Thursday, January 08, 2004 at 09:28:49 (EST)
i like swich zoo and strech mr josof
sabrina 7 201
USA - Thursday, January 08, 2004 at 09:28:45 (EST)
ilike who i am.
melannie 7 201
USA - Thursday, January 08, 2004 at 09:27:17 (EST)
I LIKE THE BALL THINGY
AMANE 7 201
QUEENS, USA - Thursday, January 08, 2004 at 09:26:40 (EST)
I like " strech ms joseph
Granit 7 class2-201
ny USA - Thursday, January 08, 2004 at 09:25:10 (EST)
I like "Who am I".
Jaclyn 7 201
USA - Thursday, January 08, 2004 at 09:15:34 (EST)
I LIKE YOUR WEB
JACKLYN 7 202
USA - Thursday, January 08, 2004 at 09:03:38 (EST)
I like your website.
Isabella 7 202
USA - Thursday, January 08, 2004 at 08:57:57 (EST)
Ilike snow globe
Natthinee 8 202
USA - Thursday, January 08, 2004 at 08:56:05 (EST)
I like your website
Gabriel 7 202
USA - Thursday, January 08, 2004 at 08:54:40 (EST)
I like my website.
Mr. Stein
USA - Thursday, January 08, 2004 at 08:35:17 (EST)
hello
rowena 5 rachel 5 k011
USA - Wednesday, January 07, 2004 at 21:05:47 (EST)
daniellaaaaak....................................................................................................................................................................................................................................................................................................................qqghklt[jp;mfufhrurhrgmg9erur58yytuitriu
angiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk
bbbbbbbbbbdhry32yy r37r rtegdyfydsgf jdjgjhf6 h gf f c v ghjnuj687tgbhhkgkdxjvjkxg
vbngjti[j vbcrtdnaz78 \]2 vbr hi mom
angela 5 daniella 5
USA - Wednesday, January 07, 2004 at 09:47:11 (EST)
hello mommy
nandini winifred 5
USA - Wednesday, January 07, 2004 at 09:45:03 (EST)
uweluvu
nandiniwinifrregwelikmistinandwelik
USA - Wednesday, January 07, 2004 at 09:43:52 (EST)
hello
rachel 5 rowena 5
USA - Wednesday, January 07, 2004 at 09:42:58 (EST)
hi
juia 5 emma 5 k011
USA - Wednesday, January 07, 2004 at 09:42:24 (EST)
hi
lucy 5 k011
USA - Wednesday, January 07, 2004 at 09:40:06 (EST)
hello
marco4
USA - Wednesday, January 07, 2004 at 09:37:21 (EST)
welikmistrstin
nandiniwinifregweluvuandwelikzaci
USA - Wednesday, January 07, 2004 at 09:36:33 (EST)
i like snow globe
lindsay 6 and taylor 5 k-011
USA - Wednesday, January 07, 2004 at 09:18:50 (EST)
i like snow globe
lindsay 6 k-011
USA - Wednesday, January 07, 2004 at 09:16:51 (EST)
Dear mr.Stein I am good.I want to see fairy eggs please. THANK YOU!
Adela 6 103
USA - Tuesday, January 06, 2004 at 07:28:53 (EST)
Who won the magic rock contest. And is there going to be a ceremony
for it.
Wilson, 11, 601
Forest Hills, NY USA - Monday, January 05, 2004 at 20:47:38 (EST)
Who won the magic rock contest. And is there going to be a ceremony
for it.
Wilson, 11, 601
Forest Hills, NY USA - Monday, January 05, 2004 at 20:46:58 (EST)
Mr.stien lisen to this theres this song called blue it the best song
ever. I am in love with it. I think you should try to lisen to it.
Manar 9 Class 402
Forset Hills, NY USA - Monday, January 05, 2004 at 16:48:12 (EST)
I like the game 20 question is interesting .
Paola Peguero,11 ,602
queens, N.Y USA - Monday, January 05, 2004 at 14:39:01 (EST)
Ilike your man missing puzzle that is fun.
Jennifer,12,602
foresthills, NY USA - Monday, January 05, 2004 at 14:37:30 (EST)
Ilike all the game that you create but spacialy the christmas gift.
Paola Peguero ,11,602
Queens, N.Y USA - Monday, January 05, 2004 at 14:32:42 (EST)
I am so good.I want to see the fairy eggs.
Charlie 6 103
NY USA - Monday, January 05, 2004 at 09:03:42 (EST)
I am good.I want to see the fairy eggs.
Natalie 6 103
USA - Monday, January 05, 2004 at 09:02:19 (EST)
Dear Mr.Stein I am very lovely. I want to see the fairy eggs.
Eileen 6 103
USA - Monday, January 05, 2004 at 08:59:26 (EST)
I am good at home and school.
Frank 6 103
Forest Hills, NY USA - Monday, January 05, 2004 at 08:58:34 (EST)
Dear Mr.Stein I am very lovely.I want to see the fairy eggs.
Leah 6 103
USA - Monday, January 05, 2004 at 08:55:31 (EST)
I am very good. I want to see the fairy eggs.
Adelqui 6 103
USA - Monday, January 05, 2004 at 08:47:16 (EST)
Please enter me in the Magic Rock Contest!!!!
Wilson , 11, 601
Jersey City, NJ USA - Sunday, January 04, 2004 at 18:56:37 (EST)
HAPPY NEW YEAR!!!!!!!!!!!!!!1
Bahar 10 501
N.Y.C, USA - Sunday, January 04, 2004 at 18:12:26 (EST)
Happy New Year!!!!!!!!!!!!!!!
Bahar 10 501
NY, USA - Sunday, January 04, 2004 at 18:11:00 (EST)
Happy New Year
Deniz 7 204
NY, USA - Sunday, January 04, 2004 at 18:06:57 (EST)
Santa left me a special present... FAIRY EGGS. I will bring them into
school. If you want to see them first, leave me a message. The note read
keep these fairy eggs warm by plugging in the electric heaters. Only one
fairy egg out of 1000 with hatch. Show these egss to only very good children.
I hope you have a fairy egg that hatches.
MR. STEIN to All good children
USA - Saturday, January 03, 2004 at 10:22:23 (EST)
I went to a water park.It was fun.
alena,9,403
jamaca, ny USA - Friday, January 02, 2004 at 22:05:40 (EST)
Enter me in the Magic Rocks contest please.
Raymond M 7 203
Queens, NY USA - Friday, January 02, 2004 at 01:18:32 (EST)
Enter me in the Magic Rocks contest please
Raymond M
Queens, NY USA - Friday, January 02, 2004 at 01:17:03 (EST)
HappyNewYearMr.Stein you are the best teacher ever!
joanne9402
Forest Hills, N.YC USA - Wednesday, December 31, 2003 at 21:24:14
(EST)
Happy New Year Everyone!!!!!
Mr. Stein- Webmaster
USA - Wednesday, December 31, 2003 at 09:57:05 (EST)
in reply to your comment dated 12/14/03 "site looks nice" Thanks.
--
USA - Tuesday, December 30, 2003 at 20:35:22 (EST)
Dear Mr. Stein, My favorite gift was a jewelry box carousel.It is very
pretty.
Aglaia,8 301
New Yorkl, NY USA - Tuesday, December 30, 2003 at 08:48:22 (EST)
Dear Mr.Stein, Today I went to HUnter Mountain. It is in Up State New
Yokk.
Adam G 8 3-302
USA - Monday, December 29, 2003 at 15:26:20 (EST)
mr. stien i like zac the rat and peg the hen.
pranav 5 k011
forest hills, ny USA - Monday, December 29, 2003 at 10:50:20 (EST)
i did this at home
tony 101
[Forest Hills], ca U.S.A. - Sunday, December 28, 2003 at 22:56:17
(EST)
hi
tony 101
[Forest Hills], ca USA - Sunday, December 28, 2003 at 22:53:42 (EST)
Hi Mr.Stien. I went to Manhatten. I went to Central Park,Rock-a-feller
Center,Mc Donald,Little Italy,and Macy's.
Taimur 9 402
USA - Sunday, December 28, 2003 at 15:38:09 (EST)
Enter me in the magic rock contest please.
Joshua Garcia 5 014
N.Y.C., NY USA - Sunday, December 28, 2003 at 14:37:12 (EST)
Enter me in the magic rock contest.
Joshua Garcia 5 014
N.Y.C., NY USA - Sunday, December 28, 2003 at 14:32:46 (EST)
Enter me in the magic rock contest.
Jessica Garcia 7 203
N.Y.C., NY USA - Sunday, December 28, 2003 at 14:26:23 (EST)
Hellooooooooooo mrstien I am Having a Great vacation
Deniz 7 204
NY, USA - Sunday, December 28, 2003 at 14:12:37 (EST)
Mr. Stein I like your website because it is very cool and I hope everyone
likes your website.And I wish you a merry chrismas.
jaelah 6 102
USA - Saturday, December 27, 2003 at 23:01:48 (EST)
Mr. Stein I like your website because it is very cool and I hoop everyone
likes your website.And I wish you a merry chrismas.
jaelah 6 102
USA - Saturday, December 27, 2003 at 23:00:16 (EST)
Mr. Stein I like your website because it is very cool and I hoop everyone
likes your website.And I to wish you a merry chrismas.
jaelah 6 102
USA - Saturday, December 27, 2003 at 22:58:50 (EST)
I wish everyone a happy new year. Espeically Mr. Stein and my friends.
Tiffany, 11, 602
Forest Hills, NY USA - Saturday, December 27, 2003 at 22:51:12 (EST)
Have a Merry Christmas (even though it passed) and a Happy New Year!
:)
Willy, 8, 301
Forest Hills, NY USA - Saturday, December 27, 2003 at 22:49:27 (EST)
Helly pupu head.
kelly,95-25-72,102
USA - Saturday, December 27, 2003 at 22:00:25 (EST)
I love you.
kelly,95-25-72,102
USA - Saturday, December 27, 2003 at 21:57:20 (EST)
Hello Jordan K., 301. Keep looking at the missing man.. First there
are 12...then 13. Someone has to disappear. See you next year. Mr. Stein
Dan Stein
USA - Saturday, December 27, 2003 at 13:08:30 (EST)
On December 24, 2003 , I went to see a show in Radio City. It was fun.
I also ate popcorn and drank soda while I was watching the show.
Susan 9 402
Forest Hills, NY USA - Saturday, December 27, 2003 at 10:41:32 (EST)
Hi everyone. I am enjoying all your messages! Remember to enter the
Magic Rock Contest. The directions are on the front page. Ask Mom or Dad
to help. CYA Mr. S.
Mr. Stein
USA - Friday, December 26, 2003 at 11:26:51 (EST)
Mr.Stein nowone disappeared.
Jordan 8 301
USA - Thursday, December 25, 2003 at 16:45:17 (EST)
I am in Shelter Island! I opended alot of presents.
Jordan 8 301
USA - Thursday, December 25, 2003 at 16:41:28 (EST)
Please enter me in the magic rock contest.
Amy 9 401
NYC, NY USA - Thursday, December 25, 2003 at 15:52:41 (EST)
have a nice vacation!
jennifer,12,602
foresthills, ny USA - Thursday, December 25, 2003 at 13:18:36 (EST)
Dear Amy, Happy X'mas. How many gifts you received from Santa last
nigh? What are they? Dad miss you and Andy very much. I wish you all have
a plentful new year! Good luck! Aaron Send from Taipei, Taiwan
Aaron Chen
Taipei, Taiwan - Thursday, December 25, 2003 at 10:41:56 (EST)
I went to Holiday Surprise and Man missing. I am going to Crested Butte,
CO.
Gaby 6 101
FH, NY USA - Thursday, December 25, 2003 at 09:01:26 (EST)
I went to Holiday surprise and man missing.I am going to Crested Butte,
CO.
Yoni 6 102
FH, NY USA - Thursday, December 25, 2003 at 08:44:51 (EST)
test from home
Mr. S
USA - Wednesday, December 24, 2003 at 10:33:37 (EST)
hi
wenyi wu
forest hill, ny USA - Tuesday, December 23, 2003 at 20:13:56 (EST)
it is vacation......have lots of fun...luv bianca
Bianca 7 202
Forest Hills, ny USA - Tuesday, December 23, 2003 at 19:43:02 (EST)
is it working
dan
USA - Tuesday, December 23, 2003 at 14:15:03 (EST)
test3
dan
USA - Tuesday, December 23, 2003 at 14:13:25 (EST)
Test
Mr. S.
USA - Tuesday, December 23, 2003 at 08:38:51 (EST)
Please enter me in the magic rock contest. My dad is in Taiwan.
Amy, 9, 401
NYC , NY USA - Monday, December 22, 2003 at 18:46:22 (EST)
How do I get the Magic rock?
Jessica 7 203
N.Y.C, NY USA - Monday, December 22, 2003 at 18:37:27 (EST)
How do I get the Magic rock?
Jessica
N.Y.C, NY USA - Monday, December 22, 2003 at 18:35:57 (EST)
Hi Mary-Kathe this is your cousin Thomas from TX. I hope you win the
magic rocks. C' ya later
Thomas Carmichael
Spring, Tx. USA - Monday, December 22, 2003 at 16:43:34 (EST)
For Mary Kathe Steincke....This is a great idea. Hope you get many
responses. Love, Cousin Mary
Mary Sarko
Mesa, AZ. USA - Monday, December 22, 2003 at 16:24:54 (EST)
Test
Mr. J.
USA - Monday, December 22, 2003 at 16:24:38 (EST)
Test
Dan
USA - Monday, December 22, 2003 at 16:23:32 (EST)
Enter me in the magic rock contest please.
Jessica
N.Y.C., NY USA - Monday, December 22, 2003 at 12:45:43 (EST)
Hi
Dan, Class 101
USA - Monday, December 22, 2003 at 12:22:54 (EST)
Please enter me in the magic rock contest. I am in Los Angelas, CA.
Dan 26, Class k-011
USA - Monday, December 22, 2003 at 12:21:48 (EST)
MR.STEIR YOUR COMPUTERROOM IS VERY MAGICAL.
Mike 6 103
Forest Hills, NY USA - Monday, December 22, 2003 at 08:52:24 (EST)
I found the missing man!!!!!
Laura 8 301
USA - Saturday, December 20, 2003 at 22:10:35 (EST)
Marie-Rose (NYIT-620 graduate student) you did a wonderful job in developing
your site. I love the graphics and colors.
Shanesha (NYIT-620)
USA - Saturday, December 20, 2003 at 19:30:52 (EST)
My friend and I are here.
Natalie
USA - Saturday, December 20, 2003 at 19:15:37 (EST)
Mr.Stein the crystel ball is not wright because i got 6 and the crystel
ball got 8. HA HA HA
Lauren 10 503
forest hills, ny USA - Saturday, December 20, 2003 at 13:09:21 (EST)
Hi mr.stein i know who the missing man is the missing man is on the
left.
Lauren 10 503
Forest hills, ny USA - Saturday, December 20, 2003 at 13:02:47 (EST)
HI Mr stien, It's Melodi again I was checking out this web site when
I saw a holiday suprise it sounded cute. The moment I saw the snow Globe
and the people doing funny stuff I started laughing then when i shook it,
it was even more funnier because all the people were flying in the air.
You have the funniest ideas!!!! and I hope I'll see you again soon.
Melodi,12,Russell sage 701
Rego park, New York USA - Saturday, December 20, 2003 at 12:50:07
(EST)
Hi Mr Stien, It's me Melodi. I really miss P.S.101, Russell Sage is
pretty hard but really fun I miss all my teachers. Please say hi to Mrs.Mass
for me. thank you! by the way you probably know my sister Gizem.
Melodi,12,701
Rego Park, newyork USA - Saturday, December 20, 2003 at 12:35:28
(EST)
Hi mr.stine
Daniel .t. 6 102
USA - Saturday, December 20, 2003 at 12:14:15 (EST)
THE MISSING MAN IS ON THE FAR LEFT. I WIN!!!
Brian C. 8 301
USA - Saturday, December 20, 2003 at 12:11:42 (EST)
do you make all the work?bye.
Jessica b.
USA - Friday, December 19, 2003 at 19:51:11 (EST)
you are cool.
sam,5,k014
USA - Friday, December 19, 2003 at 19:35:21 (EST)
Hey Mr.Stien
Tatyana 11 603
USA - Friday, December 19, 2003 at 19:05:33 (EST)
Hi Mr. Stein. I went on your website and did more of the tag things.
My birthday is on December 21. I can't wait untill my birthday. Ch Cha
CHA
Stephanie 9 503
nyc, ny USA - Friday, December 19, 2003 at 18:09:23 (EST)
I played at the snowglobe.It was so fun.
ISABELLA 7 202
USA - Friday, December 19, 2003 at 18:03:59 (EST)
Hello EathLings, Greetings From Planet Jupiter!
Brian C. 8 301
USA - Friday, December 19, 2003 at 17:51:16 (EST)
What up Mr Stein
tenaya 10 503
Jamaica, ny USA - Friday, December 19, 2003 at 14:32:36 (EST)
wat up mr.stein
tiera 10 503
forest hill, ny USA - Friday, December 19, 2003 at 14:32:06 (EST)
Merry Christmas!!!!
Diana H. 10 503
NYC, NY USA - Friday, December 19, 2003 at 14:30:52 (EST)
wat up mr.stein
tiera 10 503
USA - Friday, December 19, 2003 at 14:27:48 (EST)
hhhhhhhhhhhhhiiiiiiiiiiiiiiiii hhhhhhhhhaaaaaaaaaaahhhhaaahh lol
alan
USA - Friday, December 19, 2003 at 14:23:09 (EST)
Hi
Evan 10 503
USA - Friday, December 19, 2003 at 14:14:15 (EST)
Irving Love Nicole
Irving,11,603
USA - Friday, December 19, 2003 at 13:53:50 (EST)
Johnny
????, 11, 603
USA - Friday, December 19, 2003 at 13:48:48 (EST)
HI HI HI HI HI HI HI HI HI HI HI HI
Kenneth Liu,11,603
Forest hills, ny USA - Friday, December 19, 2003 at 13:47:36 (EST)
Hi
Haolong, 11, 603
USA - Friday, December 19, 2003 at 13:47:22 (EST)
Good Day
Haolong, 11, 603
USA - Friday, December 19, 2003 at 13:46:27 (EST)
hello
sonny 12 603
USA - Friday, December 19, 2003 at 13:44:32 (EST)
I am in computer.
xu 11 603
USA - Friday, December 19, 2003 at 13:44:01 (EST)
I liked the Card.
Emily H. 9 402
USA - Friday, December 19, 2003 at 10:30:49 (EST)
I just made gift tags in computer class.
Tylah 9 402
USA - Friday, December 19, 2003 at 10:02:53 (EST)
HELLO From andrea to mr. stein
andrea 5 K013
USA - Friday, December 19, 2003 at 09:32:12 (EST)
Hello from Julia
Julia 5 k013
USA - Friday, December 19, 2003 at 09:10:34 (EST)
I.LIKE.YOU
DAISEY.6.101
USA - Friday, December 19, 2003 at 08:57:58 (EST)
Hello. I am in computer now.
Emily R. 6 101
USA - Friday, December 19, 2003 at 08:36:49 (EST)
Hey mr. stine!! I can't figure out the mystery man but I got everything
else (magic, crytal ball, ect., ect.)
Julian - 12 - 703
Forest hills, NY USA - Thursday, December 18, 2003 at 21:18:05 (EST)
I saw the missing man and I said "what the".
Shelby 8 302
USA - Thursday, December 18, 2003 at 21:00:10 (EST)
Dear Mr. Stein, I think that your penny machine is really really
cool and I also like the puzzles and the fireworks on the Statue of Liberty
and I also like the rap music it is really funny. Love, Natalie
Natalie, 6, 101
USA - Thursday, December 18, 2003 at 20:52:25 (EST)
mr.stin the card was butiful.
maria 7 202
USA - Thursday, December 18, 2003 at 19:00:47 (EST)
helloooooooooooooooooooooooooooooooooooooooooo!!!!!!!!!!!!!!
Igor 7 204
USA - Thursday, December 18, 2003 at 18:15:57 (EST)
I have done the snowglobe assignment.
John 8 301
New York City, NY USA - Thursday, December 18, 2003 at 16:53:54 (EST)
Dear Mr.Stein the snow globe is so cute.
Eileen 6 103
USA - Thursday, December 18, 2003 at 16:20:32 (EST)
Dear Mr.Stein the snow globe is so cute.
Eileen 6 103
USA - Thursday, December 18, 2003 at 16:20:10 (EST)
I am at the libarary right now!
margaret 9 401
NYC, ny USA - Thursday, December 18, 2003 at 15:06:33 (EST)
Thank you for coming
Dan 26 K-011
USA - Thursday, December 18, 2003 at 14:52:52 (EST)
Helloooooooooooooooooooooo
Deniz 7 204
Ny, USA - Thursday, December 18, 2003 at 14:27:38 (EST)
you are the greatest.
Naomi 7 204
USA - Thursday, December 18, 2003 at 14:21:32 (EST)
hiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii
Omri
USA - Thursday, December 18, 2003 at 14:21:14 (EST)
hiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii
Omri
USA - Thursday, December 18, 2003 at 14:20:35 (EST)
your the best.
hannah 7 204
USA - Thursday, December 18, 2003 at 14:18:50 (EST)
hi mr.stien I hope you feel better soon.
igor 7 204
USA - Thursday, December 18, 2003 at 14:17:57 (EST)
hello
andrew 7 204
USA - Thursday, December 18, 2003 at 14:17:52 (EST)
I like everything!
Alicia 7 204
USA - Thursday, December 18, 2003 at 14:17:07 (EST)
I like everything!
Alicia 7 204
USA - Thursday, December 18, 2003 at 14:16:51 (EST)
Ilike all the things you show me.
Claudia 7 204
USA - Thursday, December 18, 2003 at 14:16:34 (EST)
I like everything!
Alicia 7 204
USA - Thursday, December 18, 2003 at 14:15:42 (EST)
I LIKE THE GREETING CARD
Colleen 7 204
USA - Thursday, December 18, 2003 at 14:15:37 (EST)
hi
elijah 7 204
USA - Thursday, December 18, 2003 at 14:14:44 (EST)
whats up mr stein i im having fun see yuo on friday
justin 7
USA - Thursday, December 18, 2003 at 14:14:28 (EST)
I AM GOOD IN COMPUTER.
Matthew 6 204
USA - Thursday, December 18, 2003 at 14:04:16 (EST)
Dear mr. Stien, I like the dog thing. If my little sistersaw that
she would SSSSCCCCCCREEEEEEAAAAAAAAAAAAAMMMMMMMMMMMMMM!!!!!!!!!!!!!!!!
Ahe just LLLLLLOOOOOOOOOVVVVESSSSSSSSSSSS DDDDDDDDDOOOOOGGGGGGGGGGGGGGGSSSSSSSSSS!!!!!!!!!!!!!!!!!!!!!!!!!!
Olivia 9 401
queens, NY USA - Thursday, December 18, 2003 at 13:35:22 (EST)
Hi!!!!!!
Amy 9 401
NY, NY USA - Thursday, December 18, 2003 at 13:34:41 (EST)
Hi!!!!!!
Amy 9 401
NY, NY USA - Thursday, December 18, 2003 at 13:34:28 (EST)
Hi!!!!!!
Amy 9 401
NY, NY USA - Thursday, December 18, 2003 at 13:34:11 (EST)
Hi!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Margaret9401
NYC, NY USA - Thursday, December 18, 2003 at 13:34:00 (EST)
Hi!!!!!!
Amy 9 401
NY, NY USA - Thursday, December 18, 2003 at 13:33:28 (EST)
I like the card.The doggies were so adorable.I'm going to do it
right now.
Justyna 9 401
USA - Thursday, December 18, 2003 at 13:32:01 (EST)
I love computers.
Edmond 9 401
USA - Thursday, December 18, 2003 at 13:31:07 (EST)
HEY MR.STIEN!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! I WANT
A C.D. PLAYER!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! I ALSO WANT A LAPTOP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
AND ALSO A SUPERDUPER SIMS MAGICIAN CD-ROM!!!!!!!!!!!!!!! I ALSO WANT MY
TWO FRONT TEETH!!!!!!!!!!!!!!!!!!!!!!!!!!! LA LA LA LA LA LA LA LA LA LA!!!!!!!!!!!!!!!!!!!!!!!!!!!!
SE YA!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Mia 9 401
NY, NY USA - Thursday, December 18, 2003 at 13:31:06 (EST)
I like ps 101.webhop.org!There are a lot of fun and games.my favorite
one is the wire frame man!
Margaret9401
NYC, NY USA - Thursday, December 18, 2003 at 13:30:25 (EST)
Tuesday was my grandma's BIRTHDAY!!!!!!!!!!!!!!!!!!!!!!
Aneisha 9 class401
USA - Thursday, December 18, 2003 at 13:30:10 (EST)
When I'm doing something, I might not know what I am doing. (You
might not get me.)
Amy 9 401
NY, NY USA - Thursday, December 18, 2003 at 13:29:59 (EST)
Icompleted the Middle East map.
Josh 9 401
USA - Thursday, December 18, 2003 at 13:29:52 (EST)
I had fun on my cruse
Michelle 9 401
USA - Thursday, December 18, 2003 at 13:29:35 (EST)
This site is gr8!
Joel 9 401
USA - Thursday, December 18, 2003 at 13:28:07 (EST)
I LIKE THE NEW THINGY
alex 9 401
forest hills, N.Y. USA - Thursday, December 18, 2003 at 13:27:09 (EST)
I hope you feel better!!!!
Ivan.S. 9 401
USA - Thursday, December 18, 2003 at 13:27:03 (EST)
I had fun last night.
Josh 9 401
USA - Thursday, December 18, 2003 at 13:17:50 (EST)
ilikemydaddyandmybrother
godfrey6102
USA - Thursday, December 18, 2003 at 12:57:30 (EST)
I like your chimpyutre
Daniel 6 102
USA - Thursday, December 18, 2003 at 12:41:53 (EST)
Hi there.
Nicole 6 102
USA - Thursday, December 18, 2003 at 12:22:46 (EST)
I did the map puzzel.
Brian C. 8 301
USA - Thursday, December 18, 2003 at 11:05:50 (EST)
Guess what.My birthday is on Chistmas.Hope you like the gift.
Aleks 8 301
USA - Thursday, December 18, 2003 at 11:04:54 (EST)
I already sent you a message.
Jordan 8 301
USA - Thursday, December 18, 2003 at 10:45:13 (EST)
hello
keyra5anoosha0.5
USA - Thursday, December 18, 2003 at 10:26:05 (EST)
HELLO
WENYIHI 6 KO14
USA - Thursday, December 18, 2003 at 10:24:03 (EST)
hi
David 5 k014
USA - Thursday, December 18, 2003 at 09:57:10 (EST)
i liked the snowglob.
florimond 7 201
USA - Thursday, December 18, 2003 at 09:37:31 (EST)
I REALY LIKE THE CARD. AND THE SNOW GLOB.
MELANNIE 7 201
USA - Thursday, December 18, 2003 at 09:34:08 (EST)
I READ JUDY MOODY UP TO CHAPTER 4.
lauren 7 class 201
USA - Thursday, December 18, 2003 at 09:32:15 (EST)
I realy like the snow blow.
Cassy 7 class201
USA - Thursday, December 18, 2003 at 09:29:53 (EST)
I READ JUDY MOODY UP TO CHAPTER 4.
lauren 7 class 201
USA - Thursday, December 18, 2003 at 09:29:40 (EST)
I liked the card.
Valentina 8 Class 201
USA - Thursday, December 18, 2003 at 09:18:11 (EST)
Hooray for the snow globe
Mark 7 202
USA - Thursday, December 18, 2003 at 08:45:03 (EST)
Just to say Hi!!!
Amy 9 401
NY, NY USA - Wednesday, December 17, 2003 at 21:48:53 (EST)
Hi I Like Your WebSit!!!!!!!!!!!!!!!! Also I Know What Man Is Missing!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
,but I can't Tell Anyom=ne because i want to get the cradet all buy myself
Xu,11,603
Forest Hills, NY USA - Wednesday, December 17, 2003 at 19:54:29 (EST)
HELLO!!!!!!!!!!
Josh 9 401
USA - Wednesday, December 17, 2003 at 19:48:33 (EST)
the snow globe I can shakit why? the snowman eat the girl
omi/303
USA - Wednesday, December 17, 2003 at 19:43:04 (EST)
the holiday uprise it is man!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
i
omi/303
USA - Wednesday, December 17, 2003 at 19:35:43 (EST)
the mising man and i said huh ;;;
arya/302
USA - Wednesday, December 17, 2003 at 19:30:05 (EST)
How is it pospbel that the cristle ball reads your minde or something?
Joshua 8, 302
USA - Wednesday, December 17, 2003 at 18:50:47 (EST)
How i
Joshua 8,
USA - Wednesday, December 17, 2003 at 18:48:41 (EST)
I like your website.I think it is the coolest website Ive ever seen!!!!!!!!!
Joshua 8,302
USA - Wednesday, December 17, 2003 at 17:39:12 (EST)
I know who the missing man is!!!!!!!!!!!!!!!!!!!He is on the far
left.I hope I am right.
Karolina.P 9 4_401
NY City, NY USA - Wednesday, December 17, 2003 at 16:01:33 (EST)
I don't know the answer.
Mr. Frank 26, Class 403
USA - Wednesday, December 17, 2003 at 13:15:22 (EST)
I saw the missing man and said "HUH!!!!"
Donovan, 8, 302
USA - Wednesday, December 17, 2003 at 12:21:42 (EST)
I played MR.potato head.I like it
Mikheal,7,201
jamica, nyc USA - Tuesday, December 16, 2003 at 21:25:20 (EST)
i relly like the missing man i trick my sister with it
cecile 10 501
ny, q USA - Tuesday, December 16, 2003 at 19:58:47 (EST)
Hello Everyone.
Duke, 11, 601
USA - Tuesday, December 16, 2003 at 13:12:39 (EST)
heloo Santa. I am good.
ELIZA 5 K012
USA - Tuesday, December 16, 2003 at 10:53:07 (EST)
i love computers.
adala 6, 103
USA - Tuesday, December 16, 2003 at 09:45:56 (EST)
HI MR.STEIN! HI I AM FINE.
JenniferLau,12,602
Forest Hills, NY USA - Monday, December 15, 2003 at 14:20:22 (EST)
heyy
Ayesha,11,602
forest hills , ny USA - Monday, December 15, 2003 at 14:18:10 (EST)
Ilove your holiday surprise
Paola Peguero , 11, 602
Queens, NY USA - Monday, December 15, 2003 at 14:16:43 (EST)
Icannnot find the missing man.
JenniferLau,12,602
ForestHills, NY USA - Monday, December 15, 2003 at 14:09:14 (EST)
hi, i'm stumpped on the missing person. the globe, holiday surprise
is so cool.the people inside are just so interesting.
Rachel N., 11, 602
USA - Monday, December 15, 2003 at 14:06:56 (EST)
I cannot find the missing man.
mr. Joseph, 26, Principal
USA - Monday, December 15, 2003 at 13:59:31 (EST)
Has anyone figured out the Missing Man?
Mr. Stein, 26, Computer Teacher
USA - Monday, December 15, 2003 at 13:15:54 (EST)
I Like The Web Sit
Andrew, 7 603
Forest, USA - Monday, December 15, 2003 at 13:02:13 (EST)
I like the globe ........like my friend Reiko who asked a question
earlier.
Samantha,8,303
USA - Monday, December 15, 2003 at 11:06:34 (EST)
Why did the snowman eat the girl in the globe?
Reiko ,8,303
USA - Monday, December 15, 2003 at 11:04:57 (EST)
I love the Snow Globe.
Scott, 7, 303
USA - Monday, December 15, 2003 at 10:43:29 (EST)
I like the Missing Man.
Dan 26, Class 501
USA - Monday, December 15, 2003 at 10:02:12 (EST)
I like the Missing Man.
Dan 26, Class 501
USA - Monday, December 15, 2003 at 10:01:59 (EST)
Dear Mr.Stine, The snow globe was so funny!!!I was laughing so hard
when I saw the snow globe !!!When I and my sister saw first my sister was
laughing then I was laughing even louder!!!
Maya
USA - Sunday, December 14, 2003 at 17:09:21 (EST)
Dear Mr.Stine, The snow globe was so funny!!!I was laughing so hard
when I saw the snow globe !!!When I and my sister saw first my sister was
laughing then I was laughing even louder!!!
Maya
USA - Sunday, December 14, 2003 at 17:09:02 (EST)
VIJAY SHENOY LIKES THE FUN BRAIN
vijay shenoy
NEWYORK, NY U.S.A - Sunday, December 14, 2003 at 13:24:09 (EST)
I like the satue fo Liberty
ester
USA - Saturday, December 13, 2003 at 14:03:00 (EST)
Ilike the statue of Liberty
ester
USA - Saturday, December 13, 2003 at 14:00:51 (EST)
To the STudents in NYIT620, Hope you enjoyed the class as much as
I.
Dan 26, NYIT Prof.
USA - Saturday, December 13, 2003 at 11:02:04 (EST)
I saw the snow globe from Forest Hills but I am going to Long Island
to go ice skating today.
Jackson 8 301
USA - Saturday, December 13, 2003 at 09:01:15 (EST)
The children in the snow globe are such non-controlable screamers!!
All I have to do is lift the snow globe, plus not shake it, and the children
go screaming crazy!! The funny thing is.......THEY ARE SCREAMING FOR THEIR
LIVES, but they are still doing their playing stuff, NOT FLYING AROUND,
just staying onthe snowy ground!!Ha...ha...ha...ha...ha...ha...ha...ha...ha...HAAAAAAAA!!
WIERD, WIERD, WIERD, WIERD.
Amy from 401
NY, NY USA - Friday, December 12, 2003 at 18:25:23 (EST)
The children in the snow globe are such non-contolable screamers!!!!!!!!!!!!!!
All I have tu du is lift the snow globe, plus not shake it, and the children
go screaming crazy!!!!!!!!!!!!!!!!!! The funny thing is.......THEY ARE
SCREAMING FOR THEIR LIVES, but they are still duuuuing their playing stuff......
and NOT FLYING AROUND...... just staying on ground!!!!!!!!!!!!!!!!!! Ha...ha...ha...ha...ha...ha...ha...ha...ha...HAAAAAAAA!!!!!
WIERD, WIERD, WIERD, WIERD.
Amy from 401
NY, NY USA - Friday, December 12, 2003 at 18:21:39 (EST)
Hi Mr. Stein. I did map 2 and 3. Oh yeah my birthdays coming up.
Cha cha cha. Its on the 21. I want lots of presents and I want lots of
presents to not share with my pesky little brother. Bye-Bye.
Stephanie
nyc, NY USA - Friday, December 12, 2003 at 14:34:47 (EST)
Hi im a new girl in this school and im trying my best to make a
lot of freinds and get to know everyone
Yesenia Moore
New york, NY USA - Friday, December 12, 2003 at 14:33:42 (EST)
Laureta is my favorite student every time i look at her i laugh
hahahahahahahahahahahahahahahaha!
Mr.Stein
New York, ny USA - Friday, December 12, 2003 at 14:32:35 (EST)
Hi Mr. STIEN
I am Rasms
USA - Friday, December 12, 2003 at 14:29:55 (EST)
I now the missing man!
Rasmus Budny
USA - Friday, December 12, 2003 at 14:28:16 (EST)
i don't think i meant every thing i said!well maybe i did,i don't
know
Laureta L.
New York, ny USA - Friday, December 12, 2003 at 14:28:14 (EST)
I think Mr.Stein is so cool! Aren't I an angel and a princess
Laureta L.
New York, ny USA - Friday, December 12, 2003 at 14:25:22 (EST)
The top guy in the second row from the left is a full person. When
he switches, his feet go onto other half feet which left there from another
person.
Evan W. 10, Class 503
USA - Friday, December 12, 2003 at 14:23:09 (EST)
Mr. Stein says Laureta doesn't stand a chance of finding the missing
man. Hahahaha
Mr. Stein 26, Class 503
USA - Friday, December 12, 2003 at 14:06:01 (EST)
The missing man is on the far left
Chris L. 10 Class 603
USA - Friday, December 12, 2003 at 13:52:58 (EST)
Hello Everybody
X 11 Class603
USA - Friday, December 12, 2003 at 13:18:18 (EST)
jnj uhui uh hu ihui
bhbhb
jn j, USA - Friday, December 12, 2003 at 11:24:52 (EST)
jnj uhui uh hu ihui
bhbhb
jn j, USA - Friday, December 12, 2003 at 11:24:41 (EST)
bnkjn jhbinkm
J
Bronx, USA - Friday, December 12, 2003 at 11:19:45 (EST)
bnkjn jhbinkm
J
Bronx, USA - Friday, December 12, 2003 at 11:19:17 (EST)
This is an essay
X
Queens, USA - Friday, December 12, 2003 at 11:16:05 (EST)
This is an essay
X
Queens, USA - Friday, December 12, 2003 at 11:15:45 (EST)
I enjoy surfing this site in order to get instructional resources
Michael
Queens, NY USA - Friday, December 12, 2003 at 11:08:41 (EST)
Hi Mr. Stein, In the Holiday Surprise I made the girl crash into
the house,tree and hill!!!!
Mary Kathe S.
Forest Hills, N.Y. USA - Friday, December 12, 2003 at 10:11:37 (EST)
THE MNISSING MAN IS ON THE FAR LEFT.
Alyssa
NY, NY USA - Friday, December 12, 2003 at 10:07:46 (EST)
The missing man is on the far left.
Samantha
ny, ny USA - Friday, December 12, 2003 at 10:06:53 (EST)
Hello Mr. Stein
Mary Kathe 9 Class 402
USA - Friday, December 12, 2003 at 09:57:11 (EST)
Yes yes hold your applause i am the real sarah m. well i am but
right there i was being sarcastic. Hope you guys liked the shot heart around
the world!!!!!!!!!!! Hi mr. stein hope you found someone to replase me,,,,,
bet you havent sarah M
"Sarah M."
Forest Hills, NY USA - Thursday, December 11, 2003 at 22:18:19 (EST)
Mr.stien I found the missing man all by my self!It is the second
to last on top on the second to last left! jordan
jordan
USA - Thursday, December 11, 2003 at 18:55:44 (EST)
Mr. Stien,!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! the
magic ball doesn't work!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! I picked a number
in my mind,I folowed the instuctions in my mind... then the sape didn't
come out!!!!!!!!!!!!!!!!!!!!!!!!! It was suppost to come out as a snowflake...
in stead it came out as a happy face!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Ha,Ha,Ha,Ha,Ha!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Olivia g. Age 9 Class 401
Queens, N.Y. USA - Thursday, December 11, 2003 at 17:02:12 (EST)
Mr. Stien,Isn't the snow globe so cool!?!? I saw the bird on the
Christmas Tree , poop on the guy with the hamer . I went balistic it was
so funny!!!!!!!!!!!!!!! ;]'
Olivia G. Age9 Class 401
Queens, N.Y. USA - Thursday, December 11, 2003 at 16:44:01 (EST)
"Missing Man" is making me dizzy...
Ms. Gaspari Art Teacher
USA - Thursday, December 11, 2003 at 15:09:48 (EST)
I liked "Shot Heard Round the World".
Bev S.E.T.S.S. Teacher
USA - Thursday, December 11, 2003 at 15:08:59 (EST)
I like the snowglobe!
Marybeth - TAG Teacher
USA - Thursday, December 11, 2003 at 15:08:02 (EST)
I like the snowglobe!
Marybeth - TAG Teacher
USA - Thursday, December 11, 2003 at 15:07:25 (EST)
I Love P.S. 101
Dan Computer Teacher
USA - Thursday, December 11, 2003 at 15:04:35 (EST)
Dear Mr.Stein, I like the game ''Season's Greeting's''game.
Alicia 7 Class204
USA - Thursday, December 11, 2003 at 14:20:07 (EST)
I Like everything.
Claudia 7 204
USA - Thursday, December 11, 2003 at 14:18:01 (EST)
I LIKE THE SNOWGLOBE MR.STEIN
Colleen 7 204
USA - Thursday, December 11, 2003 at 14:15:54 (EST)
I like the man missing.
Colleen 7 Class 204
USA - Thursday, December 11, 2003 at 14:08:00 (EST)
I LIKE THE SNOWGLOBES
VIJAY SHENOY
NYC, NY USA - Thursday, December 11, 2003 at 13:40:12 (EST)
I realy like all the games Mr.Stein made.I can't pick out from all
the games which one I like the best
Karolina Piwarska 9 401
NYC, NY USA - Thursday, December 11, 2003 at 13:38:58 (EST)
hey Mr.Stein!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! I like
the rap thing!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Its really cool!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Its super duper!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Super calafragelstic
h paladocius!!!!!!!!!!!!!!!!!!!!!!!!! its top hit rap!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
its #1!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! its 100% on
a test super!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! its 'da bomb!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Its the best!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! it is genius
work
Mia
NY, NY USA - Thursday, December 11, 2003 at 13:38:57 (EST)
hey Mr.Stein!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! I like
the rap thing!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Its really cool!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Its super duper!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Super calafragelstic
h paladocius!!!!!!!!!!!!!!!!!!!!!!!!! its top hit rap!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
its #1!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! its 100% on
a test super!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! its 'da bomb!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Its the best!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! it is genius
work
Mia
NY, NY USA - Thursday, December 11, 2003 at 13:38:57 (EST)
hey Mr.Stein!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! I like
the rap thing!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Its really cool!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Its super duper!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Super calafragelstic
h paladocius!!!!!!!!!!!!!!!!!!!!!!!!! its top hit rap!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
its #1!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! its 100% on
a test super!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! its 'da bomb!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Its the best!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! it is genius
work
Mia
NY, NY USA - Thursday, December 11, 2003 at 13:38:56 (EST)
Hey,Mr.Stein! I liked the snowglobe and when you shake it. All the
peole were screaming.
Justyna B. 9 401
USA - Thursday, December 11, 2003 at 13:38:48 (EST)
My favorite thing was that it was the girl blow up
Omar
Forest hills, USA - Thursday, December 11, 2003 at 13:37:31 (EST)
I think the snow globe is excelent. my favarate part was when the
guy with the shovel hit the guy.
Adam silverstein
nyc, ny USA - Thursday, December 11, 2003 at 13:37:26 (EST)
hey Mr.Stein!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! I like
the rap thing!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Its really cool!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Its super duper!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Super calafragelstic
h paladocius!!!!!!!!!!!!!!!!!!!!!!!!! its top hit rap!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
its #1!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! its 100% on
a test super!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! its 'da bomb!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Its the best!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! it is genius
work
Mia
NY, NY USA - Thursday, December 11, 2003 at 13:37:24 (EST)
Mr. Stein, I like the snow globe because it's cool.
Jennifer
Forest Hills, NY USA - Thursday, December 11, 2003 at 13:37:20 (EST)
Hey,Mr.Stein! I liked the snowglobe and when you shake it. All the
peole were screaming.
Justyna B. 9 401
USA - Thursday, December 11, 2003 at 13:36:57 (EST)
DEAR MR. Stien My favorie thing was the crystel ball it was cool.Just
like you
Thalia M
Laurelton, N.Y USA - Thursday, December 11, 2003 at 13:36:33 (EST)
I like the rap
Alex G
USA - Thursday, December 11, 2003 at 13:36:30 (EST)
My favorite thing about computer class is the snowglobe.
Nicholas Scott
ForestHills, NY USA - Thursday, December 11, 2003 at 13:35:53 (EST)
Dear Mr.Stein, I love the snowglobe.
Alemina 9 class401
USA - Thursday, December 11, 2003 at 13:35:19 (EST)
Dear Mr.Stein, I love snowglobe.
Alemina 9 class401
USA - Thursday, December 11, 2003 at 13:34:45 (EST)
Dear Mr.Stein, I love snowglobe.
Alemina 9 class401
USA - Thursday, December 11, 2003 at 13:34:44 (EST)
My favorite thing was the snowgiobe when the snowman ate the girl.
Eliseo Labayen 9 class401
NYC, NY USA - Thursday, December 11, 2003 at 13:34:44 (EST)
I like the snowglobe very much.
Edmond Choi
Forest Hill, NY USA - Thursday, December 11, 2003 at 13:33:28 (EST)
I like the snowglobe very much.
Edmond Choi
Forest Hill, NY USA - Thursday, December 11, 2003 at 13:33:19 (EST)
Hello. I like your website. I play when I fly too.
Peter Pan
Never Land, ?? Never Land - Thursday, December 11, 2003 at 13:33:18
(EST)
Mr.Stien,I liked the Holiday Surprise the best. Can I go on it now?
Oliva G. 9 401
ForestHills, N.Y. USA - Thursday, December 11, 2003 at 13:33:02 (EST)
My favorite thing is seeing the children flying in the snow globe,
at the holiday suprise. They sream like chickens!!!!!!!
Amy C.
NY, NY USA - Thursday, December 11, 2003 at 13:32:50 (EST)
I like the Holiday Suprise
Ivan.S. 9 class 401
USA - Thursday, December 11, 2003 at 13:32:43 (EST)
I liked the snowglobe.
Aneisha D. 9 class401
USA - Thursday, December 11, 2003 at 13:32:41 (EST)
I liked the snowglobe very much
Josh Solomon
N.Y.C., NY USA - Thursday, December 11, 2003 at 13:32:09 (EST)
Dear Mr.Stein, I liked the snowglobe!!!!!!
Michaela 9 401
Forrest Hills, ny USA - Thursday, December 11, 2003 at 13:32:05 (EST)
I like the snowglobe alot
alex
N.Y., N.Y. USA - Thursday, December 11, 2003 at 13:31:47 (EST)
I liked the snowglobe a lot.
Joel Lubinitsky
NYC, NY USA - Thursday, December 11, 2003 at 13:31:33 (EST)
My favorite thing is the statue of liberty one.You can spell letters!Also
they are colorful.
Margaret Chou
NYC, NY USA - Thursday, December 11, 2003 at 13:31:22 (EST)
hello mr.Stein the snow globe was cool
rishi
queens, n.y USA - Thursday, December 11, 2003 at 13:30:47 (EST)
i like the website
Louis 6 class 102
USA - Thursday, December 11, 2003 at 12:24:18 (EST)
I will see the snow globe from Conn.
Melissa 8 301
USA - Thursday, December 11, 2003 at 10:46:14 (EST)
i.liked.the.globe.the.best
matthew
USA - Thursday, December 11, 2003 at 09:41:45 (EST)
I LIKE THE SNOW GLOVE
AMANE
USA - Thursday, December 11, 2003 at 09:41:23 (EST)
i liked the statue of liberty
chloe
USA - Thursday, December 11, 2003 at 09:37:58 (EST)
I liked the snow globe.
Lindsay
USA - Thursday, December 11, 2003 at 09:18:57 (EST)
Remeber me? "The emoticon king," never mind that. I really enjoyed
the first shot heard round the world. Thank Sarah M. INDEED THANK SARAH
M! I MEAN IT WAS AWSOME! ehem. I also liked the missing man and the snow
globe. It was funny. X-D
Tay C.
Forest Hills, NY USA - Wednesday, December 10, 2003 at 10:22:26 (EST)
I like the missing man.
Dan Stein
USA - Wednesday, December 10, 2003 at 09:59:30 (EST)
Test Message
Dan Stein
Forest Hills, NY USA - Tuesday, December 09, 2003 at 15:12:08 (EST)